Mutagenetix > Incidental Mutation

Incidental Mutation 'R5802:Zc3h6'

448765

Institutional Source

Beutler Lab

Gene Symbol

Zc3h6

Ensembl Gene

ENSMUSG00000042851

Gene Name

zinc finger CCCH type containing 6

Synonyms

MMRRC Submission

043391-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.214) question?

Stock #

R5802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128967402-129018563 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 129015559 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 666 (P666L)

Ref Sequence

ENSEMBL: ENSMUSP00000105949 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110320]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110320
AA Change: P666L

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000105949
Gene: ENSMUSG00000042851
AA Change: P666L

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
coiled coil region	30	71	N/A	INTRINSIC
low complexity region	74	88	N/A	INTRINSIC
low complexity region	177	192	N/A	INTRINSIC
ZnF_C3H1	271	296	1.72e-4	SMART
ZnF_C3H1	300	325	2.51e-6	SMART
ZnF_C3H1	326	349	5.24e0	SMART
coiled coil region	351	383	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	493	509	N/A	INTRINSIC
low complexity region	698	707	N/A	INTRINSIC
low complexity region	784	798	N/A	INTRINSIC
low complexity region	815	829	N/A	INTRINSIC
low complexity region	876	890	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135186

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Ednrb	A	G	14: 103,821,714	F292S	probably damaging	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Ptpru	C	T	4: 131,788,377	E827K	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Slc6a4	C	T	11: 77,019,236	T439M	probably damaging	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tecpr1	A	T	5: 144,206,546	N670K	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trappc9	T	C	15: 72,685,339	E812G	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Xylt1	A	T	7: 117,656,691	T829S	probably benign	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Zc3h6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01732:Zc3h6	APN	2	129011875	missense	probably damaging	1.00
IGL01880:Zc3h6	APN	2	129017378	missense	probably damaging	0.99
IGL02160:Zc3h6	APN	2	128997685	missense	probably benign	0.02
IGL02161:Zc3h6	APN	2	128993226	missense	possibly damaging	0.90
IGL02202:Zc3h6	APN	2	129016581	missense	probably damaging	1.00
IGL02547:Zc3h6	APN	2	129015611	missense	probably benign	0.00
IGL02973:Zc3h6	APN	2	128997795	missense	probably damaging	0.98
BB001:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
BB011:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R0336:Zc3h6	UTSW	2	129015412	missense	possibly damaging	0.81
R0420:Zc3h6	UTSW	2	129014827	missense	probably benign	0.00
R0538:Zc3h6	UTSW	2	129017223	missense	possibly damaging	0.75
R0944:Zc3h6	UTSW	2	129006816	missense	probably damaging	1.00
R1151:Zc3h6	UTSW	2	129017136	missense	probably benign	0.00
R1528:Zc3h6	UTSW	2	129017069	missense	probably benign	0.01
R1698:Zc3h6	UTSW	2	129017358	missense	probably benign
R1712:Zc3h6	UTSW	2	129016734	missense	probably damaging	1.00
R1913:Zc3h6	UTSW	2	129016620	missense	probably damaging	1.00
R1926:Zc3h6	UTSW	2	128997795	missense	probably damaging	0.98
R2030:Zc3h6	UTSW	2	129006086	missense	probably damaging	1.00
R2051:Zc3h6	UTSW	2	129015618	missense	possibly damaging	0.55
R2133:Zc3h6	UTSW	2	128967830	missense	possibly damaging	0.53
R2273:Zc3h6	UTSW	2	129014709	missense	probably benign	0.01
R2328:Zc3h6	UTSW	2	128993202	missense	possibly damaging	0.85
R2862:Zc3h6	UTSW	2	129015460	missense	probably benign	0.43
R2899:Zc3h6	UTSW	2	129002232	missense	probably benign	0.00
R3711:Zc3h6	UTSW	2	129017331	missense	probably benign	0.00
R3743:Zc3h6	UTSW	2	128997792	missense	probably damaging	1.00
R3893:Zc3h6	UTSW	2	129016140	missense	probably damaging	1.00
R4748:Zc3h6	UTSW	2	129002240	missense	probably damaging	1.00
R5025:Zc3h6	UTSW	2	129010433	missense	possibly damaging	0.87
R5026:Zc3h6	UTSW	2	129017309	missense	probably benign	0.00
R5125:Zc3h6	UTSW	2	129014479	missense	possibly damaging	0.93
R5373:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5374:Zc3h6	UTSW	2	129002156	missense	possibly damaging	0.75
R5703:Zc3h6	UTSW	2	128993452	intron	probably benign
R5876:Zc3h6	UTSW	2	128993277	missense	probably benign	0.29
R5879:Zc3h6	UTSW	2	128997776	splice site	probably null
R5950:Zc3h6	UTSW	2	128997790	nonsense	probably null
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6031:Zc3h6	UTSW	2	128967812	missense	possibly damaging	0.85
R6781:Zc3h6	UTSW	2	129015421	missense	probably damaging	0.99
R7323:Zc3h6	UTSW	2	128993411	missense	unknown
R7340:Zc3h6	UTSW	2	128993190	missense	possibly damaging	0.90
R7572:Zc3h6	UTSW	2	129017252	missense	probably benign	0.02
R7576:Zc3h6	UTSW	2	129014553	missense	probably damaging	1.00
R7797:Zc3h6	UTSW	2	129015635	critical splice donor site	probably null
R7924:Zc3h6	UTSW	2	129015480	missense	possibly damaging	0.52
R8048:Zc3h6	UTSW	2	129017014	missense	probably benign	0.30
R8877:Zc3h6	UTSW	2	129014399	nonsense	probably null
R9076:Zc3h6	UTSW	2	129017176	nonsense	probably null
R9577:Zc3h6	UTSW	2	129016182	missense
R9687:Zc3h6	UTSW	2	129017361	missense	probably damaging	1.00
R9745:Zc3h6	UTSW	2	129017235	missense	probably benign	0.08
Z1176:Zc3h6	UTSW	2	129016221	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACCCTTACACTTTGGTGGAG -3'
(R):5'- ACCACCATTGTTTGAAGCCTG -3'

Sequencing Primer
(F):5'- CCCTTACACTTTGGTGGAGTTTGAG -3'
(R):5'- CACCATTGTTTGAAGCCTGTAACTAC -3'

Posted On

2016-12-15