Incidental Mutation 'R5802:Abca4'
ID 448770
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene Name ATP-binding cassette, sub-family A member 4
Synonyms Rim protein, RmP, D430003I15Rik, Abc10
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5802 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 121838092-121973772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121847881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 67 (L67F)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
AlphaFold O35600
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: L67F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: L67F

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132199
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 121,856,353 (GRCm39) splice site probably null
IGL00229:Abca4 APN 3 121,964,603 (GRCm39) missense probably damaging 1.00
IGL00858:Abca4 APN 3 121,967,537 (GRCm39) missense probably damaging 0.97
IGL01316:Abca4 APN 3 121,935,404 (GRCm39) missense probably damaging 0.99
IGL01357:Abca4 APN 3 121,897,232 (GRCm39) missense probably damaging 1.00
IGL01784:Abca4 APN 3 121,932,154 (GRCm39) missense probably benign 0.22
IGL01903:Abca4 APN 3 121,949,050 (GRCm39) splice site probably benign
IGL02008:Abca4 APN 3 121,969,750 (GRCm39) missense probably benign 0.00
IGL02113:Abca4 APN 3 121,904,127 (GRCm39) missense possibly damaging 0.90
IGL02142:Abca4 APN 3 121,963,575 (GRCm39) missense probably benign 0.01
IGL02200:Abca4 APN 3 121,862,663 (GRCm39) missense probably benign 0.00
IGL02203:Abca4 APN 3 121,973,457 (GRCm39) missense probably benign
IGL02306:Abca4 APN 3 121,952,044 (GRCm39) missense probably damaging 1.00
IGL02307:Abca4 APN 3 121,935,395 (GRCm39) missense probably damaging 1.00
IGL02673:Abca4 APN 3 121,897,150 (GRCm39) missense probably damaging 1.00
IGL02864:Abca4 APN 3 121,937,080 (GRCm39) missense probably damaging 1.00
IGL02886:Abca4 APN 3 121,921,863 (GRCm39) missense probably damaging 0.96
IGL02934:Abca4 APN 3 121,956,008 (GRCm39) nonsense probably null
IGL02992:Abca4 APN 3 121,921,935 (GRCm39) missense probably damaging 0.96
IGL03083:Abca4 APN 3 121,932,261 (GRCm39) critical splice donor site probably null
IGL03258:Abca4 APN 3 121,931,210 (GRCm39) splice site probably benign
IGL03279:Abca4 APN 3 121,935,381 (GRCm39) missense probably benign 0.12
3-1:Abca4 UTSW 3 121,874,574 (GRCm39) missense probably benign 0.01
B6819:Abca4 UTSW 3 121,897,273 (GRCm39) splice site probably benign
K7894:Abca4 UTSW 3 121,941,517 (GRCm39) frame shift probably null
PIT4151001:Abca4 UTSW 3 121,930,670 (GRCm39) missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 121,898,965 (GRCm39) missense probably damaging 0.99
R0001:Abca4 UTSW 3 121,874,660 (GRCm39) splice site probably benign
R0091:Abca4 UTSW 3 121,932,179 (GRCm39) missense possibly damaging 0.94
R0138:Abca4 UTSW 3 121,899,098 (GRCm39) missense probably damaging 1.00
R0344:Abca4 UTSW 3 121,877,613 (GRCm39) missense probably damaging 1.00
R0347:Abca4 UTSW 3 121,913,748 (GRCm39) missense probably benign 0.00
R0508:Abca4 UTSW 3 121,917,200 (GRCm39) splice site probably benign
R0607:Abca4 UTSW 3 121,950,081 (GRCm39) missense probably damaging 1.00
R0835:Abca4 UTSW 3 121,919,862 (GRCm39) missense probably damaging 1.00
R0839:Abca4 UTSW 3 121,920,527 (GRCm39) missense probably damaging 0.99
R1138:Abca4 UTSW 3 121,967,497 (GRCm39) missense probably benign 0.13
R1448:Abca4 UTSW 3 121,956,577 (GRCm39) splice site probably null
R1453:Abca4 UTSW 3 121,862,763 (GRCm39) missense probably benign 0.04
R1533:Abca4 UTSW 3 121,928,807 (GRCm39) missense probably benign 0.07
R1645:Abca4 UTSW 3 121,948,926 (GRCm39) missense probably benign 0.00
R1763:Abca4 UTSW 3 121,957,479 (GRCm39) missense probably damaging 1.00
R1763:Abca4 UTSW 3 121,904,330 (GRCm39) missense probably benign 0.09
R1838:Abca4 UTSW 3 121,921,954 (GRCm39) missense probably benign
R1867:Abca4 UTSW 3 121,899,010 (GRCm39) missense probably damaging 1.00
R1907:Abca4 UTSW 3 121,862,661 (GRCm39) missense probably damaging 0.99
R1935:Abca4 UTSW 3 121,846,572 (GRCm39) missense probably benign 0.00
R1936:Abca4 UTSW 3 121,846,572 (GRCm39) missense probably benign 0.00
R2165:Abca4 UTSW 3 121,906,048 (GRCm39) missense possibly damaging 0.90
R2391:Abca4 UTSW 3 121,952,071 (GRCm39) missense probably benign 0.00
R2403:Abca4 UTSW 3 121,964,592 (GRCm39) missense probably damaging 1.00
R3788:Abca4 UTSW 3 121,846,561 (GRCm39) missense possibly damaging 0.50
R3814:Abca4 UTSW 3 121,964,570 (GRCm39) splice site probably benign
R4554:Abca4 UTSW 3 121,949,992 (GRCm39) missense possibly damaging 0.91
R4649:Abca4 UTSW 3 121,963,542 (GRCm39) missense probably damaging 1.00
R4653:Abca4 UTSW 3 121,932,230 (GRCm39) nonsense probably null
R4655:Abca4 UTSW 3 121,941,147 (GRCm39) missense possibly damaging 0.93
R4668:Abca4 UTSW 3 121,948,948 (GRCm39) missense possibly damaging 0.90
R4705:Abca4 UTSW 3 121,899,019 (GRCm39) missense probably damaging 0.98
R4788:Abca4 UTSW 3 121,960,361 (GRCm39) missense probably damaging 1.00
R4795:Abca4 UTSW 3 121,969,772 (GRCm39) missense probably damaging 0.99
R4999:Abca4 UTSW 3 121,899,019 (GRCm39) missense probably damaging 1.00
R5301:Abca4 UTSW 3 121,896,502 (GRCm39) missense probably damaging 0.96
R5372:Abca4 UTSW 3 121,848,988 (GRCm39) missense probably damaging 0.96
R5395:Abca4 UTSW 3 121,874,590 (GRCm39) missense probably benign 0.00
R5539:Abca4 UTSW 3 121,963,557 (GRCm39) missense probably damaging 1.00
R5583:Abca4 UTSW 3 121,942,550 (GRCm39) missense probably damaging 0.99
R5706:Abca4 UTSW 3 121,847,910 (GRCm39) missense probably benign 0.10
R5719:Abca4 UTSW 3 121,928,915 (GRCm39) critical splice donor site probably null
R5731:Abca4 UTSW 3 121,926,242 (GRCm39) missense probably damaging 1.00
R5819:Abca4 UTSW 3 121,930,630 (GRCm39) missense probably damaging 0.97
R5853:Abca4 UTSW 3 121,897,180 (GRCm39) missense probably benign
R6053:Abca4 UTSW 3 121,964,666 (GRCm39) missense probably damaging 0.99
R6135:Abca4 UTSW 3 121,932,096 (GRCm39) missense possibly damaging 0.69
R6185:Abca4 UTSW 3 121,919,789 (GRCm39) missense probably damaging 0.97
R6227:Abca4 UTSW 3 121,930,743 (GRCm39) nonsense probably null
R6293:Abca4 UTSW 3 121,935,395 (GRCm39) missense probably damaging 1.00
R6297:Abca4 UTSW 3 121,926,179 (GRCm39) missense probably benign 0.24
R6367:Abca4 UTSW 3 121,897,229 (GRCm39) missense probably damaging 1.00
R6376:Abca4 UTSW 3 121,917,309 (GRCm39) missense possibly damaging 0.95
R6405:Abca4 UTSW 3 121,967,311 (GRCm39) splice site probably null
R6525:Abca4 UTSW 3 121,931,308 (GRCm39) missense probably benign 0.00
R6602:Abca4 UTSW 3 121,932,150 (GRCm39) missense probably benign 0.00
R6681:Abca4 UTSW 3 121,915,447 (GRCm39) missense probably damaging 1.00
R6747:Abca4 UTSW 3 121,919,962 (GRCm39) splice site probably null
R6852:Abca4 UTSW 3 121,928,844 (GRCm39) missense probably damaging 0.99
R7049:Abca4 UTSW 3 121,941,497 (GRCm39) missense probably benign 0.00
R7072:Abca4 UTSW 3 121,967,592 (GRCm39) missense probably damaging 1.00
R7092:Abca4 UTSW 3 121,932,218 (GRCm39) missense probably damaging 1.00
R7110:Abca4 UTSW 3 121,926,292 (GRCm39) missense probably damaging 1.00
R7138:Abca4 UTSW 3 121,899,113 (GRCm39) nonsense probably null
R7172:Abca4 UTSW 3 121,897,189 (GRCm39) nonsense probably null
R7263:Abca4 UTSW 3 121,847,843 (GRCm39) missense probably damaging 0.99
R7414:Abca4 UTSW 3 121,896,387 (GRCm39) missense probably benign 0.28
R7537:Abca4 UTSW 3 121,967,637 (GRCm39) missense possibly damaging 0.68
R7577:Abca4 UTSW 3 121,967,663 (GRCm39) missense probably damaging 1.00
R7665:Abca4 UTSW 3 121,838,139 (GRCm39) start gained probably benign
R7758:Abca4 UTSW 3 121,921,816 (GRCm39) missense probably damaging 1.00
R7935:Abca4 UTSW 3 121,904,186 (GRCm39) missense possibly damaging 0.85
R8237:Abca4 UTSW 3 121,955,952 (GRCm39) missense probably benign 0.00
R8255:Abca4 UTSW 3 121,948,926 (GRCm39) missense probably benign 0.00
R8294:Abca4 UTSW 3 121,897,217 (GRCm39) missense possibly damaging 0.75
R8504:Abca4 UTSW 3 121,922,983 (GRCm39) missense probably benign 0.01
R8536:Abca4 UTSW 3 121,973,394 (GRCm39) missense probably benign 0.01
R8714:Abca4 UTSW 3 121,942,528 (GRCm39) missense probably benign 0.19
R8771:Abca4 UTSW 3 121,880,320 (GRCm39) missense probably damaging 0.97
R8835:Abca4 UTSW 3 121,896,433 (GRCm39) missense probably benign 0.00
R8845:Abca4 UTSW 3 121,930,651 (GRCm39) missense probably damaging 1.00
R8856:Abca4 UTSW 3 121,906,096 (GRCm39) missense probably benign
R8933:Abca4 UTSW 3 121,921,786 (GRCm39) missense probably damaging 1.00
R9052:Abca4 UTSW 3 121,940,908 (GRCm39) missense possibly damaging 0.68
R9095:Abca4 UTSW 3 121,967,556 (GRCm39) missense possibly damaging 0.52
R9221:Abca4 UTSW 3 121,921,828 (GRCm39) missense probably damaging 1.00
R9262:Abca4 UTSW 3 121,964,639 (GRCm39) missense probably damaging 1.00
R9301:Abca4 UTSW 3 121,881,128 (GRCm39) missense probably benign 0.24
R9367:Abca4 UTSW 3 121,838,197 (GRCm39) start codon destroyed probably null 0.99
R9408:Abca4 UTSW 3 121,931,274 (GRCm39) missense probably benign
R9425:Abca4 UTSW 3 121,926,344 (GRCm39) missense probably damaging 1.00
R9464:Abca4 UTSW 3 121,913,714 (GRCm39) missense probably benign 0.08
R9483:Abca4 UTSW 3 121,879,275 (GRCm39) missense
R9751:Abca4 UTSW 3 121,881,126 (GRCm39) missense probably benign 0.00
Z1176:Abca4 UTSW 3 121,950,092 (GRCm39) missense probably damaging 1.00
Z1176:Abca4 UTSW 3 121,897,137 (GRCm39) missense probably damaging 1.00
Z1177:Abca4 UTSW 3 121,967,563 (GRCm39) missense probably benign 0.21
Z1177:Abca4 UTSW 3 121,941,435 (GRCm39) missense possibly damaging 0.79
Z1189:Abca4 UTSW 3 121,877,642 (GRCm39) missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GACCATTAGTCTGCGTCCTTATCTG -3'
(R):5'- TCTGCAGAGGGTAGGTACAC -3'

Sequencing Primer
(F):5'- TGAGCCTCAGGACACAGC -3'
(R):5'- GAGGGTAGGTACACACACTCC -3'
Posted On 2016-12-15