Incidental Mutation 'R5802:Srsf12'
ID448772
Institutional Source Beutler Lab
Gene Symbol Srsf12
Ensembl Gene ENSMUSG00000054679
Gene Nameserine/arginine-rich splicing factor 12
SynonymsSfrs13b, Srrp
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location33208991-33233340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 33230929 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 141 (R141L)
Ref Sequence ENSEMBL: ENSMUSP00000103794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067864] [ENSMUST00000108159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067864
AA Change: R146L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000067939
Gene: ENSMUSG00000054679
AA Change: R146L

DomainStartEndE-ValueType
low complexity region 31 75 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
low complexity region 110 141 N/A INTRINSIC
low complexity region 145 166 N/A INTRINSIC
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 204 216 9.52e-5 PROSPERO
internal_repeat_1 232 244 9.52e-5 PROSPERO
low complexity region 248 262 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108159
AA Change: R141L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103794
Gene: ENSMUSG00000054679
AA Change: R141L

DomainStartEndE-ValueType
RRM 11 84 9.99e-24 SMART
low complexity region 105 136 N/A INTRINSIC
low complexity region 140 161 N/A INTRINSIC
low complexity region 167 191 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
Meta Mutation Damage Score 0.0862 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Srsf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Srsf12 APN 4 33226103 missense possibly damaging 0.66
IGL02245:Srsf12 APN 4 33209103 unclassified probably benign
IGL03197:Srsf12 APN 4 33231040 missense probably damaging 1.00
IGL03412:Srsf12 APN 4 33230929 missense probably damaging 0.99
R0173:Srsf12 UTSW 4 33226117 missense probably damaging 1.00
R0704:Srsf12 UTSW 4 33231069 missense probably damaging 0.99
R1618:Srsf12 UTSW 4 33230974 missense probably damaging 0.99
R2130:Srsf12 UTSW 4 33225764 critical splice acceptor site probably benign
R2916:Srsf12 UTSW 4 33231042 nonsense probably null
R2989:Srsf12 UTSW 4 33223599 missense probably damaging 1.00
R4350:Srsf12 UTSW 4 33223612 missense possibly damaging 0.80
R4946:Srsf12 UTSW 4 33231174 missense probably damaging 0.98
R5358:Srsf12 UTSW 4 33209330 missense probably damaging 0.99
R6577:Srsf12 UTSW 4 33209196 unclassified probably benign
R7055:Srsf12 UTSW 4 33226157 missense probably damaging 1.00
R7392:Srsf12 UTSW 4 33209265 missense unknown
Predicted Primers PCR Primer
(F):5'- CAATACTTGAGTCTGGGGAGG -3'
(R):5'- GCGTGACTGTGATTTCTCCATC -3'

Sequencing Primer
(F):5'- CTGGAACTGTGTGACCTACCATG -3'
(R):5'- CCATCGACTTGGACCTTTTGGG -3'
Posted On2016-12-15