Mutagenetix > Incidental Mutation

Incidental Mutation 'R5802:Tecpr1'

448779

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

043391-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 144206546 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 670 (N670K)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

probably benign
Transcript: ENSMUST00000085701
AA Change: N670K

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: N670K

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130962

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137149

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153103

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153751

Meta Mutation Damage Score

0.1660

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Ednrb	A	G	14: 103,821,714	F292S	probably damaging	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Ptpru	C	T	4: 131,788,377	E827K	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Slc6a4	C	T	11: 77,019,236	T439M	probably damaging	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trappc9	T	C	15: 72,685,339	E812G	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Xylt1	A	T	7: 117,656,691	T829S	probably benign	Het
Zc3h6	C	T	2: 129,015,559	P666L	possibly damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- AGGTCTCTTCTCGCTAAGCC -3'
(R):5'- ATTCAACTCCCAAAAGCGGTG -3'

Sequencing Primer
(F):5'- TTCTCGCTAAGCCCATGAGGAC -3'
(R):5'- AATTCCGGGCTTTGCTAGACAAG -3'

Posted On

2016-12-15