Incidental Mutation 'R5802:Loxl3'
ID 448780
Institutional Source Beutler Lab
Gene Symbol Loxl3
Ensembl Gene ENSMUSG00000000693
Gene Name lysyl oxidase-like 3
Synonyms Lor2
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R5802 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 83011186-83029547 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83026270 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 453 (T453A)
Ref Sequence ENSEMBL: ENSMUSP00000000707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
AlphaFold Q9Z175
Predicted Effect possibly damaging
Transcript: ENSMUST00000000707
AA Change: T453A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: T453A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Meta Mutation Damage Score 0.1081 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Loxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Loxl3 APN 6 83,025,747 (GRCm39) unclassified probably benign
IGL01370:Loxl3 APN 6 83,026,468 (GRCm39) missense probably damaging 1.00
IGL02126:Loxl3 APN 6 83,025,628 (GRCm39) missense probably damaging 1.00
IGL02128:Loxl3 APN 6 83,027,564 (GRCm39) missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83,027,114 (GRCm39) missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83,027,114 (GRCm39) missense probably damaging 1.00
R1725:Loxl3 UTSW 6 83,012,574 (GRCm39) missense probably benign 0.00
R1771:Loxl3 UTSW 6 83,026,890 (GRCm39) missense probably damaging 1.00
R2017:Loxl3 UTSW 6 83,025,958 (GRCm39) missense probably damaging 0.99
R2291:Loxl3 UTSW 6 83,014,469 (GRCm39) missense probably benign 0.07
R3731:Loxl3 UTSW 6 83,027,652 (GRCm39) critical splice donor site probably null
R4179:Loxl3 UTSW 6 83,014,565 (GRCm39) missense probably benign 0.00
R5230:Loxl3 UTSW 6 83,012,775 (GRCm39) missense probably benign 0.16
R5385:Loxl3 UTSW 6 83,027,593 (GRCm39) missense probably damaging 0.99
R5591:Loxl3 UTSW 6 83,025,018 (GRCm39) missense probably damaging 1.00
R5664:Loxl3 UTSW 6 83,026,863 (GRCm39) missense probably benign 0.12
R5769:Loxl3 UTSW 6 83,027,581 (GRCm39) missense probably damaging 0.98
R5771:Loxl3 UTSW 6 83,012,780 (GRCm39) splice site probably null
R5831:Loxl3 UTSW 6 83,025,999 (GRCm39) missense probably benign 0.01
R5945:Loxl3 UTSW 6 83,014,492 (GRCm39) missense probably damaging 1.00
R6542:Loxl3 UTSW 6 83,025,147 (GRCm39) missense probably benign 0.00
R6687:Loxl3 UTSW 6 83,027,645 (GRCm39) missense probably damaging 1.00
R7961:Loxl3 UTSW 6 83,027,790 (GRCm39) missense possibly damaging 0.88
R8009:Loxl3 UTSW 6 83,027,790 (GRCm39) missense possibly damaging 0.88
R8122:Loxl3 UTSW 6 83,026,240 (GRCm39) missense probably damaging 1.00
R8278:Loxl3 UTSW 6 83,025,697 (GRCm39) missense probably damaging 1.00
R8373:Loxl3 UTSW 6 83,025,872 (GRCm39) missense possibly damaging 0.89
R8411:Loxl3 UTSW 6 83,027,605 (GRCm39) missense probably damaging 1.00
R8539:Loxl3 UTSW 6 83,026,507 (GRCm39) missense probably benign
R8684:Loxl3 UTSW 6 83,012,566 (GRCm39) missense probably benign 0.23
R8782:Loxl3 UTSW 6 83,025,051 (GRCm39) missense probably benign
R8801:Loxl3 UTSW 6 83,025,629 (GRCm39) missense probably damaging 1.00
R8859:Loxl3 UTSW 6 83,014,526 (GRCm39) missense probably damaging 1.00
R8864:Loxl3 UTSW 6 83,012,739 (GRCm39) missense probably damaging 0.99
R9031:Loxl3 UTSW 6 83,012,503 (GRCm39) missense probably damaging 1.00
R9081:Loxl3 UTSW 6 83,025,638 (GRCm39) missense possibly damaging 0.67
R9176:Loxl3 UTSW 6 83,026,292 (GRCm39) missense probably damaging 0.99
R9369:Loxl3 UTSW 6 83,027,393 (GRCm39) missense probably benign 0.26
R9634:Loxl3 UTSW 6 83,027,835 (GRCm39) missense probably benign 0.10
V1024:Loxl3 UTSW 6 83,012,719 (GRCm39) missense probably damaging 1.00
X0009:Loxl3 UTSW 6 83,015,461 (GRCm39) missense probably damaging 1.00
Z1177:Loxl3 UTSW 6 83,025,141 (GRCm39) missense probably benign 0.00
Z1177:Loxl3 UTSW 6 83,015,559 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCTACTCAGGCCCGGACATC -3'
(R):5'- TCCAGTGAGGTTATAGGTTCCAG -3'

Sequencing Primer
(F):5'- ACAGCCCTGCCATCTGTGAG -3'
(R):5'- ATAGGTTCCAGTTTCCAGGGCC -3'
Posted On 2016-12-15