Incidental Mutation 'R5802:Loxl3'
ID448780
Institutional Source Beutler Lab
Gene Symbol Loxl3
Ensembl Gene ENSMUSG00000000693
Gene Namelysyl oxidase-like 3
SynonymsLor2
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83034173-83052562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83049289 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 453 (T453A)
Ref Sequence ENSEMBL: ENSMUSP00000000707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000707] [ENSMUST00000089645] [ENSMUST00000101257] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000134606]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000707
AA Change: T453A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000707
Gene: ENSMUSG00000000693
AA Change: T453A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 408 3.72e-51 SMART
SR 418 526 8.5e-37 SMART
Pfam:Lysyl_oxidase 530 730 3.9e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101257
SMART Domains Protein: ENSMUSP00000098815
Gene: ENSMUSG00000000693

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SR 45 146 2.1e-50 SMART
SR 170 283 1.09e-25 SMART
SR 308 396 5.46e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132099
Predicted Effect probably benign
Transcript: ENSMUST00000134606
SMART Domains Protein: ENSMUSP00000115547
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
Pfam:Trypsin 7 180 2.7e-15 PFAM
Pfam:Trypsin_2 20 158 3.1e-24 PFAM
PDZ 209 283 2.86e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144058
Predicted Effect probably benign
Transcript: ENSMUST00000150217
SMART Domains Protein: ENSMUSP00000118234
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 4 11 N/A INTRINSIC
Pfam:Trypsin 41 215 1.6e-11 PFAM
Pfam:Trypsin_2 53 190 1.8e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204318
Meta Mutation Damage Score 0.1081 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysyl oxidase, which likely functions as an amine oxidase and plays a role in the formation of crosslinks in collagens and elastin. Deletion of the related gene in mouse causes neonatal mortality with cleft palate, spine deformity, and defects in collagen organization. A mutation in this gene was found in a family with Stickler syndrome. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality shortly after birth, craniofacial and vertebral abnormalities associated with collagen deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Loxl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Loxl3 APN 6 83048766 unclassified probably benign
IGL01370:Loxl3 APN 6 83049487 missense probably damaging 1.00
IGL02126:Loxl3 APN 6 83048647 missense probably damaging 1.00
IGL02128:Loxl3 APN 6 83050583 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R0241:Loxl3 UTSW 6 83050133 missense probably damaging 1.00
R1725:Loxl3 UTSW 6 83035593 missense probably benign 0.00
R1771:Loxl3 UTSW 6 83049909 missense probably damaging 1.00
R2017:Loxl3 UTSW 6 83048977 missense probably damaging 0.99
R2291:Loxl3 UTSW 6 83037488 missense probably benign 0.07
R3731:Loxl3 UTSW 6 83050671 critical splice donor site probably null
R4179:Loxl3 UTSW 6 83037584 missense probably benign 0.00
R5230:Loxl3 UTSW 6 83035794 missense probably benign 0.16
R5385:Loxl3 UTSW 6 83050612 missense probably damaging 0.99
R5591:Loxl3 UTSW 6 83048037 missense probably damaging 1.00
R5664:Loxl3 UTSW 6 83049882 missense probably benign 0.12
R5769:Loxl3 UTSW 6 83050600 missense probably damaging 0.98
R5771:Loxl3 UTSW 6 83035799 unclassified probably null
R5831:Loxl3 UTSW 6 83049018 missense probably benign 0.01
R5945:Loxl3 UTSW 6 83037511 missense probably damaging 1.00
R6542:Loxl3 UTSW 6 83048166 missense probably benign 0.00
R6687:Loxl3 UTSW 6 83050664 missense probably damaging 1.00
R8009:Loxl3 UTSW 6 83050809 missense possibly damaging 0.88
R8122:Loxl3 UTSW 6 83049259 missense probably damaging 1.00
R8278:Loxl3 UTSW 6 83048716 missense probably damaging 1.00
V1024:Loxl3 UTSW 6 83035738 missense probably damaging 1.00
X0009:Loxl3 UTSW 6 83038480 missense probably damaging 1.00
Z1177:Loxl3 UTSW 6 83038578 nonsense probably null
Z1177:Loxl3 UTSW 6 83048160 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCTACTCAGGCCCGGACATC -3'
(R):5'- TCCAGTGAGGTTATAGGTTCCAG -3'

Sequencing Primer
(F):5'- ACAGCCCTGCCATCTGTGAG -3'
(R):5'- ATAGGTTCCAGTTTCCAGGGCC -3'
Posted On2016-12-15