Incidental Mutation 'R5802:Hbb-bs'
ID448784
Institutional Source Beutler Lab
Gene Symbol Hbb-bs
Ensembl Gene ENSMUSG00000052305
Gene Namehemoglobin, beta adult s chain
Synonymsbeta s
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103826534-103828096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103826672 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 146 (Y146C)
Ref Sequence ENSEMBL: ENSMUSP00000023934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023934] [ENSMUST00000153218]
Predicted Effect probably damaging
Transcript: ENSMUST00000023934
AA Change: Y146C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023934
Gene: ENSMUSG00000052305
AA Change: Y146C

DomainStartEndE-ValueType
Pfam:Globin 8 112 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131960
Predicted Effect probably benign
Transcript: ENSMUST00000153218
SMART Domains Protein: ENSMUSP00000115607
Gene: ENSMUSG00000052305

DomainStartEndE-ValueType
Pfam:Globin 8 103 3.8e-29 PFAM
Meta Mutation Damage Score 0.8627 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes a beta polypeptide chain found in adult hemoglobin, which consists of a tetramer of two alpha chains and two beta chains, and which functions in the transport of oxygen to various peripheral tissues. This gene is one of a cluster of beta-hemoglobin genes that are distally regulated by a locus control region, and which are organized along the chromosome in the order of their developmental expression. In mouse, two major strain-specific haplotypes of the beta-globin gene cluster are found - a "single" haplotype found in C57BL/-type strains, which includes two highly similar adult beta-globin genes, beta s and beta t, and a "diffuse" haplotype found in strains such as BALB/c and 129Sv, which includes two somewhat diverse adult beta-globin genes, beta-major and beta-minor. This gene represents the beta s adult gene found in the "single" haplotype. Primary chromosome 7 of the mouse reference genome assembly, which is derived from C57BL/6 strain mice, represents the "single" haplotype, while the "diffuse" haplotype is represented in the reference genome collection by the BALB/c strain alternate contig, NT_095534.1. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Hbb-bs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02507:Hbb-bs APN 7 103827884 splice site probably benign
IGL03120:Hbb-bs APN 7 103827778 splice site probably benign
R0219:Hbb-bs UTSW 7 103826669 missense possibly damaging 0.78
R2243:Hbb-bs UTSW 7 103827811 missense possibly damaging 0.51
R4297:Hbb-bs UTSW 7 103826744 missense probably benign 0.42
R4921:Hbb-bs UTSW 7 103826720 missense probably damaging 0.98
R6908:Hbb-bs UTSW 7 103827534 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCATAAACCCTTCTATGACACAG -3'
(R):5'- TCAGCAGTTTAAGGTTGCAAAC -3'

Sequencing Primer
(F):5'- TTGCCAACAACTGACAGA -3'
(R):5'- GCAGTTTAAGGTTGCAAACAAATGTC -3'
Posted On2016-12-15