Incidental Mutation 'R5802:Xylt1'
ID448785
Institutional Source Beutler Lab
Gene Symbol Xylt1
Ensembl Gene ENSMUSG00000030657
Gene Namexylosyltransferase 1
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location117380979-117673580 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117656691 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 829 (T829S)
Ref Sequence ENSEMBL: ENSMUSP00000032892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032892]
Predicted Effect probably benign
Transcript: ENSMUST00000032892
AA Change: T829S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032892
Gene: ENSMUSG00000030657
AA Change: T829S

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 41 68 N/A INTRINSIC
low complexity region 75 104 N/A INTRINSIC
Pfam:Branch 322 577 7.8e-53 PFAM
Pfam:Xylo_C 607 787 2.6e-73 PFAM
Meta Mutation Damage Score 0.1604 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial preweaning lethality, impaired chondrocyte maturation and decreased skeletal length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Xylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Xylt1 APN 7 117650685 missense probably damaging 0.99
IGL01306:Xylt1 APN 7 117548890 missense probably benign 0.00
IGL01656:Xylt1 APN 7 117548993 missense probably damaging 1.00
IGL02152:Xylt1 APN 7 117634770 missense probably damaging 1.00
IGL02188:Xylt1 APN 7 117634737 missense probably damaging 1.00
IGL02732:Xylt1 APN 7 117591937 missense possibly damaging 0.75
IGL02944:Xylt1 APN 7 117634757 missense probably benign 0.00
IGL03308:Xylt1 APN 7 117637751 nonsense probably null
IGL03393:Xylt1 APN 7 117593713 missense probably damaging 1.00
phloem UTSW 7 117656584 missense probably damaging 1.00
xylem UTSW 7 117592036 missense probably damaging 1.00
ANU23:Xylt1 UTSW 7 117548890 missense probably benign 0.00
PIT4378001:Xylt1 UTSW 7 117548865 missense possibly damaging 0.83
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0023:Xylt1 UTSW 7 117634701 missense probably damaging 1.00
R0970:Xylt1 UTSW 7 117634736 missense probably damaging 0.96
R1433:Xylt1 UTSW 7 117591952 missense possibly damaging 0.51
R1762:Xylt1 UTSW 7 117637761 missense probably benign 0.00
R2169:Xylt1 UTSW 7 117667437 missense probably damaging 1.00
R2937:Xylt1 UTSW 7 117634784 missense probably benign 0.04
R3024:Xylt1 UTSW 7 117548648 missense probably damaging 1.00
R3855:Xylt1 UTSW 7 117593550 missense probably damaging 1.00
R4006:Xylt1 UTSW 7 117475513 missense probably benign 0.01
R4329:Xylt1 UTSW 7 117656461 missense probably damaging 1.00
R4794:Xylt1 UTSW 7 117637635 missense probably benign 0.07
R4975:Xylt1 UTSW 7 117667342 missense probably damaging 1.00
R5225:Xylt1 UTSW 7 117592036 missense probably damaging 1.00
R5679:Xylt1 UTSW 7 117643650 missense probably damaging 1.00
R5707:Xylt1 UTSW 7 117656494 missense possibly damaging 0.95
R5756:Xylt1 UTSW 7 117650700 missense probably damaging 0.97
R6057:Xylt1 UTSW 7 117591908 missense probably benign 0.02
R6249:Xylt1 UTSW 7 117667305 missense probably benign 0.11
R6298:Xylt1 UTSW 7 117656737 missense probably damaging 0.96
R7159:Xylt1 UTSW 7 117637602 missense probably damaging 1.00
R7198:Xylt1 UTSW 7 117656584 missense probably damaging 1.00
R7323:Xylt1 UTSW 7 117592047 critical splice donor site probably null
R7449:Xylt1 UTSW 7 117592005 missense possibly damaging 0.55
R7545:Xylt1 UTSW 7 117593585 missense probably benign 0.11
R7786:Xylt1 UTSW 7 117643475 splice site probably null
R7849:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7867:Xylt1 UTSW 7 117475514 missense probably benign 0.12
R7932:Xylt1 UTSW 7 117656668 missense probably benign 0.06
R7950:Xylt1 UTSW 7 117475514 missense probably benign 0.12
R8169:Xylt1 UTSW 7 117650619 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCTGTTCCGGAACTTTGG -3'
(R):5'- ATTGGGGAAGCTTTGCTCTC -3'

Sequencing Primer
(F):5'- AAGGGGCCCAATGTGACC -3'
(R):5'- AGAGCACTCACCTGGTTT -3'
Posted On2016-12-15