Mutagenetix > Incidental Mutations

Incidental Mutation 'R5802:Xylt1'

448785

Institutional Source

Beutler Lab

Gene Symbol

Xylt1

Ensembl Gene

ENSMUSG00000030657

Gene Name

xylosyltransferase 1

Synonyms

MMRRC Submission

043391-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R5802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

117380979-117673580 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 117656691 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 829 (T829S)

Ref Sequence

ENSEMBL: ENSMUSP00000032892 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032892]

Predicted Effect

probably benign
Transcript: ENSMUST00000032892
AA Change: T829S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032892
Gene: ENSMUSG00000030657
AA Change: T829S

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	41	68	N/A	INTRINSIC
low complexity region	75	104	N/A	INTRINSIC
Pfam:Branch	322	577	7.8e-53	PFAM
Pfam:Xylo_C	607	787	2.6e-73	PFAM

Meta Mutation Damage Score

0.1604

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit partial preweaning lethality, impaired chondrocyte maturation and decreased skeletal length. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Ednrb	A	G	14: 103,821,714	F292S	probably damaging	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Ptpru	C	T	4: 131,788,377	E827K	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Slc6a4	C	T	11: 77,019,236	T439M	probably damaging	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tecpr1	A	T	5: 144,206,546	N670K	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trappc9	T	C	15: 72,685,339	E812G	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Zc3h6	C	T	2: 129,015,559	P666L	possibly damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Xylt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Xylt1	APN	7	117650685	missense	probably damaging	0.99
IGL01306:Xylt1	APN	7	117548890	missense	probably benign	0.00
IGL01656:Xylt1	APN	7	117548993	missense	probably damaging	1.00
IGL02152:Xylt1	APN	7	117634770	missense	probably damaging	1.00
IGL02188:Xylt1	APN	7	117634737	missense	probably damaging	1.00
IGL02732:Xylt1	APN	7	117591937	missense	possibly damaging	0.75
IGL02944:Xylt1	APN	7	117634757	missense	probably benign	0.00
IGL03308:Xylt1	APN	7	117637751	nonsense	probably null
IGL03393:Xylt1	APN	7	117593713	missense	probably damaging	1.00
phloem	UTSW	7	117656584	missense	probably damaging	1.00
xylem	UTSW	7	117592036	missense	probably damaging	1.00
ANU23:Xylt1	UTSW	7	117548890	missense	probably benign	0.00
PIT4378001:Xylt1	UTSW	7	117548865	missense	possibly damaging	0.83
R0023:Xylt1	UTSW	7	117634701	missense	probably damaging	1.00
R0023:Xylt1	UTSW	7	117634701	missense	probably damaging	1.00
R0970:Xylt1	UTSW	7	117634736	missense	probably damaging	0.96
R1433:Xylt1	UTSW	7	117591952	missense	possibly damaging	0.51
R1762:Xylt1	UTSW	7	117637761	missense	probably benign	0.00
R2169:Xylt1	UTSW	7	117667437	missense	probably damaging	1.00
R2937:Xylt1	UTSW	7	117634784	missense	probably benign	0.04
R3024:Xylt1	UTSW	7	117548648	missense	probably damaging	1.00
R3855:Xylt1	UTSW	7	117593550	missense	probably damaging	1.00
R4006:Xylt1	UTSW	7	117475513	missense	probably benign	0.01
R4329:Xylt1	UTSW	7	117656461	missense	probably damaging	1.00
R4794:Xylt1	UTSW	7	117637635	missense	probably benign	0.07
R4975:Xylt1	UTSW	7	117667342	missense	probably damaging	1.00
R5225:Xylt1	UTSW	7	117592036	missense	probably damaging	1.00
R5679:Xylt1	UTSW	7	117643650	missense	probably damaging	1.00
R5707:Xylt1	UTSW	7	117656494	missense	possibly damaging	0.95
R5756:Xylt1	UTSW	7	117650700	missense	probably damaging	0.97
R6057:Xylt1	UTSW	7	117591908	missense	probably benign	0.02
R6249:Xylt1	UTSW	7	117667305	missense	probably benign	0.11
R6298:Xylt1	UTSW	7	117656737	missense	probably damaging	0.96
R7159:Xylt1	UTSW	7	117637602	missense	probably damaging	1.00
R7198:Xylt1	UTSW	7	117656584	missense	probably damaging	1.00
R7323:Xylt1	UTSW	7	117592047	critical splice donor site	probably null
R7449:Xylt1	UTSW	7	117592005	missense	possibly damaging	0.55
R7545:Xylt1	UTSW	7	117593585	missense	probably benign	0.11
R7786:Xylt1	UTSW	7	117643475	splice site	probably null
R7849:Xylt1	UTSW	7	117656668	missense	probably benign	0.06
R7867:Xylt1	UTSW	7	117475514	missense	probably benign	0.12
R8169:Xylt1	UTSW	7	117650619	missense	probably damaging	0.99
R8686:Xylt1	UTSW	7	117381359	missense	unknown
R8942:Xylt1	UTSW	7	117634744	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGCTGTTCCGGAACTTTGG -3'
(R):5'- ATTGGGGAAGCTTTGCTCTC -3'

Sequencing Primer
(F):5'- AAGGGGCCCAATGTGACC -3'
(R):5'- AGAGCACTCACCTGGTTT -3'

Posted On

2016-12-15