Incidental Mutation 'R5802:Cdon'
ID448790
Institutional Source Beutler Lab
Gene Symbol Cdon
Ensembl Gene ENSMUSG00000038119
Gene Namecell adhesion molecule-related/down-regulated by oncogenes
SynonymsCDO, CAM-related/down-regulated by oncogenes
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35421128-35507652 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35454420 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 155 (I155N)
Ref Sequence ENSEMBL: ENSMUSP00000119206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129] [ENSMUST00000137200] [ENSMUST00000151682] [ENSMUST00000154652]
Predicted Effect probably damaging
Transcript: ENSMUST00000042842
AA Change: I155N

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: I155N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119129
AA Change: I155N

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: I155N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
FN3 717 800 1.89e-11 SMART
FN3 822 909 7.01e-6 SMART
transmembrane domain 962 984 N/A INTRINSIC
low complexity region 1101 1111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127264
SMART Domains Protein: ENSMUSP00000115216
Gene: ENSMUSG00000038119

DomainStartEndE-ValueType
IGc2 1 51 6.26e-5 SMART
IG_like 18 62 1.06e2 SMART
IGc2 81 134 6.45e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137200
Predicted Effect probably damaging
Transcript: ENSMUST00000151682
AA Change: I155N

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119206
Gene: ENSMUSG00000038119
AA Change: I155N

DomainStartEndE-ValueType
IGc2 40 103 1.35e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154652
AA Change: I155N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117499
Gene: ENSMUSG00000038119
AA Change: I155N

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 40 103 1.35e-9 SMART
IG 125 212 7.25e-1 SMART
IGc2 233 296 1.38e-6 SMART
IGc2 323 386 4.62e-17 SMART
IGc2 416 506 5e-13 SMART
FN3 573 660 2.18e-2 SMART
Meta Mutation Damage Score 0.1265 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Cdon
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Cdon APN 9 35478116 missense probably damaging 1.00
IGL01307:Cdon APN 9 35457564 missense probably benign 0.01
IGL01528:Cdon APN 9 35470107 missense possibly damaging 0.95
IGL01663:Cdon APN 9 35483214 missense possibly damaging 0.57
IGL01723:Cdon APN 9 35503338 missense probably benign 0.05
IGL02200:Cdon APN 9 35483109 missense probably benign 0.28
IGL02444:Cdon APN 9 35473448 missense probably benign 0.09
IGL02547:Cdon APN 9 35478654 missense probably damaging 1.00
IGL02620:Cdon APN 9 35452799 missense probably benign 0.00
IGL02861:Cdon APN 9 35486957 missense probably damaging 0.96
IGL02894:Cdon APN 9 35455426 missense probably benign 0.01
IGL03153:Cdon APN 9 35477959 missense probably damaging 1.00
IGL03206:Cdon APN 9 35503306 missense probably benign
IGL03374:Cdon APN 9 35478003 missense possibly damaging 0.46
indentured UTSW 9 35452106 start codon destroyed probably null 1.00
Molar UTSW 9 35463895 missense probably benign 0.15
PIT4280001:Cdon UTSW 9 35486935 missense probably damaging 1.00
R0045:Cdon UTSW 9 35486807 missense probably benign
R0045:Cdon UTSW 9 35486807 missense probably benign
R0064:Cdon UTSW 9 35489227 missense probably benign 0.03
R0396:Cdon UTSW 9 35470130 missense probably damaging 1.00
R0403:Cdon UTSW 9 35473500 missense probably benign 0.00
R0490:Cdon UTSW 9 35452682 missense probably damaging 1.00
R0547:Cdon UTSW 9 35457498 missense possibly damaging 0.88
R0609:Cdon UTSW 9 35478611 missense probably damaging 1.00
R0645:Cdon UTSW 9 35477083 splice site probably null
R0781:Cdon UTSW 9 35456437 splice site probably benign
R1110:Cdon UTSW 9 35456437 splice site probably benign
R1391:Cdon UTSW 9 35504189 missense possibly damaging 0.51
R1574:Cdon UTSW 9 35452937 splice site probably benign
R1851:Cdon UTSW 9 35483158 missense probably damaging 1.00
R2031:Cdon UTSW 9 35504074 missense probably damaging 0.96
R2230:Cdon UTSW 9 35491926 critical splice donor site probably null
R3683:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3684:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3685:Cdon UTSW 9 35489032 missense possibly damaging 0.89
R3941:Cdon UTSW 9 35464171 missense probably benign 0.09
R4030:Cdon UTSW 9 35491906 missense probably damaging 1.00
R4084:Cdon UTSW 9 35478131 missense probably damaging 0.98
R4462:Cdon UTSW 9 35457580 missense probably damaging 0.97
R4569:Cdon UTSW 9 35476969 missense probably damaging 1.00
R4677:Cdon UTSW 9 35478605 missense probably damaging 1.00
R4869:Cdon UTSW 9 35452904 missense possibly damaging 0.71
R5032:Cdon UTSW 9 35489034 missense probably damaging 1.00
R5047:Cdon UTSW 9 35478639 missense probably damaging 1.00
R5214:Cdon UTSW 9 35483208 missense probably damaging 1.00
R5341:Cdon UTSW 9 35470135 missense probably damaging 1.00
R5410:Cdon UTSW 9 35470035 missense probably damaging 0.99
R5581:Cdon UTSW 9 35504081 missense probably benign 0.01
R5696:Cdon UTSW 9 35491866 missense possibly damaging 0.69
R5757:Cdon UTSW 9 35452772 missense probably damaging 0.98
R5845:Cdon UTSW 9 35457466 missense probably damaging 1.00
R5949:Cdon UTSW 9 35486951 missense probably benign 0.32
R6106:Cdon UTSW 9 35455408 nonsense probably null
R6245:Cdon UTSW 9 35476939 missense probably damaging 1.00
R6845:Cdon UTSW 9 35486956 nonsense probably null
R6896:Cdon UTSW 9 35452106 start codon destroyed probably null 1.00
R7060:Cdon UTSW 9 35486909 missense probably damaging 1.00
R7076:Cdon UTSW 9 35504150 missense probably benign 0.00
R7184:Cdon UTSW 9 35463895 missense probably benign 0.15
R7382:Cdon UTSW 9 35478648 missense probably damaging 1.00
R7763:Cdon UTSW 9 35454415 nonsense probably null
R7857:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7885:Cdon UTSW 9 35456522 missense probably benign 0.01
R7894:Cdon UTSW 9 35476948 missense probably damaging 1.00
R7940:Cdon UTSW 9 35456612 missense possibly damaging 0.79
R7968:Cdon UTSW 9 35456522 missense probably benign 0.01
R7977:Cdon UTSW 9 35476948 missense probably damaging 1.00
Z1177:Cdon UTSW 9 35491900 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACGGCCATTTCACGTTTCC -3'
(R):5'- AGATCATCCTATTTATACACGCCCC -3'

Sequencing Primer
(F):5'- GGCCATTTCACGTTTCCAATTTTTAC -3'
(R):5'- ATTTATACACGCCCCTGAGG -3'
Posted On2016-12-15