Incidental Mutation 'R5802:Eef1a1'
ID448792
Institutional Source Beutler Lab
Gene Symbol Eef1a1
Ensembl Gene ENSMUSG00000037742
Gene Nameeukaryotic translation elongation factor 1 alpha 1
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location78478449-78489151 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78479036 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 396 (S396P)
Ref Sequence ENSEMBL: ENSMUSP00000042457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034896] [ENSMUST00000042235] [ENSMUST00000148238] [ENSMUST00000154207] [ENSMUST00000156988]
Predicted Effect probably benign
Transcript: ENSMUST00000034896
SMART Domains Protein: ENSMUSP00000034896
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 1.3e-6 PFAM
Pfam:FAD_oxidored 37 194 2.3e-9 PFAM
Pfam:GIDA 37 435 3.5e-153 PFAM
low complexity region 518 529 N/A INTRINSIC
GIDA_assoc_3 585 658 8.31e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000042235
AA Change: S396P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042457
Gene: ENSMUSG00000037742
AA Change: S396P

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 3.4e-55 PFAM
Pfam:GTP_EFTU_D2 260 327 6.3e-16 PFAM
Pfam:GTP_EFTU_D3 333 442 5e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129380
Predicted Effect probably benign
Transcript: ENSMUST00000133002
SMART Domains Protein: ENSMUSP00000123414
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
GIDA_assoc_3 5 78 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144523
Predicted Effect probably benign
Transcript: ENSMUST00000148238
SMART Domains Protein: ENSMUSP00000121424
Gene: ENSMUSG00000032342

DomainStartEndE-ValueType
low complexity region 11 30 N/A INTRINSIC
Pfam:FAD_binding_2 37 84 7.1e-7 PFAM
Pfam:Pyr_redox_2 37 156 2.1e-7 PFAM
Pfam:FAD_oxidored 37 178 1.1e-9 PFAM
Pfam:GIDA 37 184 8.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150960
Predicted Effect probably benign
Transcript: ENSMUST00000154207
SMART Domains Protein: ENSMUSP00000120438
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 238 1.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156988
SMART Domains Protein: ENSMUSP00000116821
Gene: ENSMUSG00000037742

DomainStartEndE-ValueType
Pfam:GTP_EFTU 5 186 1.9e-53 PFAM
Meta Mutation Damage Score 0.6597 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas, and the other isoform (alpha 2) is expressed in brain, heart and skeletal muscle. This isoform is identified as an autoantigen in 66% of patients with Felty syndrome. This gene has been found to have multiple copies on many chromosomes, some of which, if not all, represent different pseudogenes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Eef1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Eef1a1 APN 9 78480551 missense probably benign 0.03
R1395:Eef1a1 UTSW 9 78479018 missense probably benign 0.00
R8161:Eef1a1 UTSW 9 78480390 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTGTCTGCCTCATGTCACG -3'
(R):5'- AGGCAAGACTTAAATACACGCTG -3'

Sequencing Primer
(F):5'- GTCTGCCTCATGTCACGAACAG -3'
(R):5'- AATACACGCTGTTTTTCTTAGGTG -3'
Posted On2016-12-15