Incidental Mutation 'R5802:Cep70'
ID448794
Institutional Source Beutler Lab
Gene Symbol Cep70
Ensembl Gene ENSMUSG00000056267
Gene Namecentrosomal protein 70
SynonymsC030018L16Rik, 6720484E09Rik
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.242) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location99243367-99300404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99296405 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 519 (N519D)
Ref Sequence ENSEMBL: ENSMUSP00000139816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093795] [ENSMUST00000191335]
Predicted Effect probably damaging
Transcript: ENSMUST00000093795
AA Change: N519D

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091312
Gene: ENSMUSG00000056267
AA Change: N519D

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
low complexity region 591 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187883
Predicted Effect probably damaging
Transcript: ENSMUST00000191335
AA Change: N519D

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000139816
Gene: ENSMUSG00000056267
AA Change: N519D

DomainStartEndE-ValueType
coiled coil region 96 210 N/A INTRINSIC
coiled coil region 278 299 N/A INTRINSIC
low complexity region 319 335 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191492
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Cep70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Cep70 APN 9 99298500 unclassified probably benign
IGL02719:Cep70 APN 9 99275722 missense probably damaging 0.99
IGL02878:Cep70 APN 9 99281107 splice site probably benign
IGL02969:Cep70 APN 9 99298504 missense possibly damaging 0.88
R0426:Cep70 UTSW 9 99297684 missense probably benign 0.02
R0970:Cep70 UTSW 9 99275599 missense possibly damaging 0.93
R1238:Cep70 UTSW 9 99254265 missense probably benign 0.05
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R1462:Cep70 UTSW 9 99263720 missense probably benign 0.20
R2141:Cep70 UTSW 9 99296385 missense probably damaging 1.00
R3922:Cep70 UTSW 9 99275579 makesense probably null
R3964:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R3965:Cep70 UTSW 9 99298534 missense probably damaging 1.00
R4044:Cep70 UTSW 9 99262609 missense possibly damaging 0.66
R4174:Cep70 UTSW 9 99246313 start gained probably benign
R4659:Cep70 UTSW 9 99296341 missense possibly damaging 0.86
R4672:Cep70 UTSW 9 99254312 missense possibly damaging 0.66
R4839:Cep70 UTSW 9 99296085 missense probably benign 0.16
R5108:Cep70 UTSW 9 99263812 splice site probably null
R5288:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5386:Cep70 UTSW 9 99281075 missense probably damaging 1.00
R5934:Cep70 UTSW 9 99254265 missense probably benign 0.05
R6076:Cep70 UTSW 9 99298505 missense probably damaging 1.00
R6848:Cep70 UTSW 9 99262901 missense probably benign 0.34
R6977:Cep70 UTSW 9 99291676 missense probably damaging 1.00
R7286:Cep70 UTSW 9 99275585 missense probably damaging 1.00
R7437:Cep70 UTSW 9 99291529 missense probably damaging 1.00
R7754:Cep70 UTSW 9 99281092 missense probably damaging 1.00
R7879:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R7962:Cep70 UTSW 9 99262633 missense possibly damaging 0.54
R8063:Cep70 UTSW 9 99296122 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAGAAAGAGGTAACGTTTGATAC -3'
(R):5'- TGAGAACAAGGCAACATTGTC -3'

Sequencing Primer
(F):5'- CGCCGAACTCTCAAACTT -3'
(R):5'- GGCAACATTGTCACCAAACC -3'
Posted On2016-12-15