Incidental Mutation 'R5802:Atp2a3'
ID448797
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene NameATPase, Ca++ transporting, ubiquitous
SynonymsSerca3
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location72961169-72993044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72972882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 175 (V175A)
Ref Sequence ENSEMBL: ENSMUSP00000104125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
Predicted Effect probably damaging
Transcript: ENSMUST00000021142
AA Change: V175A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788
AA Change: V175A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108484
AA Change: V175A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788
AA Change: V175A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108485
AA Change: V175A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788
AA Change: V175A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108486
AA Change: V175A

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788
AA Change: V175A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149493
Predicted Effect probably damaging
Transcript: ENSMUST00000163326
AA Change: V175A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788
AA Change: V175A

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Meta Mutation Damage Score 0.7271 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72982787 missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72982665 missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72981897 missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72987984 missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72975339 missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72977207 missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72977128 splice site probably benign
R0193:Atp2a3 UTSW 11 72972220 missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72970931 critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72982702 missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72977232 splice site probably null
R0494:Atp2a3 UTSW 11 72981905 missense probably damaging 1.00
R0588:Atp2a3 UTSW 11 72973024 missense possibly damaging 0.79
R0674:Atp2a3 UTSW 11 72981885 missense probably damaging 1.00
R1586:Atp2a3 UTSW 11 72991744 missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72978807 critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72975414 missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72980448 missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72981797 missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72973029 missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72982680 missense probably damaging 1.00
R5083:Atp2a3 UTSW 11 72982826 missense probably null 0.49
R5174:Atp2a3 UTSW 11 72980215 missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72975397 missense probably damaging 1.00
R5304:Atp2a3 UTSW 11 72988557 missense probably damaging 0.98
R6107:Atp2a3 UTSW 11 72988461 critical splice acceptor site probably null
R6157:Atp2a3 UTSW 11 72980616 missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72982740 missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72978750 missense probably damaging 1.00
R8818:Atp2a3 UTSW 11 72981939 missense probably damaging 1.00
Z1176:Atp2a3 UTSW 11 72980622 missense possibly damaging 0.96
Z1176:Atp2a3 UTSW 11 72989540 missense probably benign
Z1177:Atp2a3 UTSW 11 72980327 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATAGCTCAGGACTCCACCTCTG -3'
(R):5'- TTTCCAGGCTGAGCTCCAAG -3'

Sequencing Primer
(F):5'- ACCTCTGGTGGAGCCTTGTC -3'
(R):5'- AAATAGCATGTTCTTCTTGTCCTGG -3'
Posted On2016-12-15