Incidental Mutation 'R5802:Dis3'
ID 448801
Institutional Source Beutler Lab
Gene Symbol Dis3
Ensembl Gene ENSMUSG00000033166
Gene Name DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms 2810028N01Rik
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5802 (G1)
Quality Score 171
Status Validated
Chromosome 14
Chromosomal Location 99075206-99099770 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99099664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 4 (S4T)
Ref Sequence ENSEMBL: ENSMUSP00000154489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650] [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000228643]
AlphaFold Q9CSH3
Predicted Effect probably benign
Transcript: ENSMUST00000022650
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042471
AA Change: S4T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166
AA Change: S4T

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
PINc 64 182 2.8e-24 SMART
low complexity region 425 436 N/A INTRINSIC
RNB 467 797 5.56e-141 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227001
Predicted Effect probably damaging
Transcript: ENSMUST00000227022
AA Change: S4T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228598
Predicted Effect possibly damaging
Transcript: ENSMUST00000228643
AA Change: S4T

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.2483 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tgds T C 14: 118,132,707 E8G probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Dis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dis3 APN 14 99082674 missense probably damaging 1.00
IGL00821:Dis3 APN 14 99091486 missense probably benign 0.00
IGL00975:Dis3 APN 14 99079234 missense probably damaging 1.00
IGL01536:Dis3 APN 14 99079423 missense probably damaging 1.00
IGL01538:Dis3 APN 14 99097745 missense probably benign 0.00
IGL02143:Dis3 APN 14 99091318 splice site probably benign
IGL02270:Dis3 APN 14 99078354 missense probably benign 0.01
IGL02354:Dis3 APN 14 99079712 nonsense probably null
IGL02361:Dis3 APN 14 99079712 nonsense probably null
IGL02650:Dis3 APN 14 99098785 missense probably benign 0.00
IGL03053:Dis3 APN 14 99098734 missense probably benign 0.00
IGL03057:Dis3 APN 14 99089990 missense possibly damaging 0.95
IGL03389:Dis3 APN 14 99095347 splice site probably benign
R0415:Dis3 UTSW 14 99087456 missense probably damaging 1.00
R0504:Dis3 UTSW 14 99081390 splice site probably benign
R1535:Dis3 UTSW 14 99079426 missense probably damaging 1.00
R1756:Dis3 UTSW 14 99086103 missense probably damaging 1.00
R1767:Dis3 UTSW 14 99084142 missense probably damaging 1.00
R1883:Dis3 UTSW 14 99091469 missense probably benign 0.21
R1938:Dis3 UTSW 14 99097590 missense probably benign 0.09
R2056:Dis3 UTSW 14 99098815 missense possibly damaging 0.90
R2133:Dis3 UTSW 14 99079877 missense probably benign 0.18
R2448:Dis3 UTSW 14 99087412 missense probably damaging 0.99
R3407:Dis3 UTSW 14 99098776 missense probably benign 0.15
R4052:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4207:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4208:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4465:Dis3 UTSW 14 99084114 missense possibly damaging 0.88
R4612:Dis3 UTSW 14 99091435 missense probably benign 0.07
R4859:Dis3 UTSW 14 99087790 missense probably damaging 1.00
R4932:Dis3 UTSW 14 99088904 missense probably damaging 1.00
R5273:Dis3 UTSW 14 99098806 missense probably benign 0.32
R5335:Dis3 UTSW 14 99097653 missense possibly damaging 0.72
R5409:Dis3 UTSW 14 99085932 missense possibly damaging 0.95
R6156:Dis3 UTSW 14 99098779 missense probably benign 0.10
R6309:Dis3 UTSW 14 99085922 missense probably benign 0.00
R7275:Dis3 UTSW 14 99087489 missense probably damaging 1.00
R7511:Dis3 UTSW 14 99099606 missense possibly damaging 0.94
R7535:Dis3 UTSW 14 99089979 missense probably benign 0.15
R7794:Dis3 UTSW 14 99098797 missense probably benign 0.04
R8013:Dis3 UTSW 14 99077399 missense possibly damaging 0.50
R8014:Dis3 UTSW 14 99077399 missense possibly damaging 0.50
R8077:Dis3 UTSW 14 99090035 missense probably benign 0.03
R8957:Dis3 UTSW 14 99099591 missense probably damaging 1.00
R9072:Dis3 UTSW 14 99095211 missense probably benign 0.44
R9073:Dis3 UTSW 14 99095211 missense probably benign 0.44
R9345:Dis3 UTSW 14 99081378 missense probably damaging 1.00
R9542:Dis3 UTSW 14 99079539 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTGGTGTCCGGCAGAAG -3'
(R):5'- CTGTAGTCCAGAGGAAAGCC -3'

Sequencing Primer
(F):5'- TGTCCGGCAGAAGGTAGTGC -3'
(R):5'- CAGAGGAAAGCCCCGCC -3'
Posted On 2016-12-15