Incidental Mutation 'R5802:Ednrb'
ID 448803
Institutional Source Beutler Lab
Gene Symbol Ednrb
Ensembl Gene ENSMUSG00000022122
Gene Name endothelin receptor type B
Synonyms ETR-b, Sox10m1, ETb
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.670) question?
Stock # R5802 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 104052061-104081838 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104059150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 292 (F292S)
Ref Sequence ENSEMBL: ENSMUSP00000154806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]
AlphaFold P48302
Predicted Effect probably damaging
Transcript: ENSMUST00000022718
AA Change: F292S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: F292S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 329 2.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 8.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172237
AA Change: F292S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: F292S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 109 328 1.9e-6 PFAM
Pfam:7TM_GPCR_Srsx 112 401 7.3e-11 PFAM
Pfam:7tm_1 118 387 4.2e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227824
AA Change: F292S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.7425 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
B3galt4 T A 17: 34,169,731 (GRCm39) D169V probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in Ednrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Ednrb APN 14 104,057,455 (GRCm39) missense probably damaging 1.00
IGL01433:Ednrb APN 14 104,080,626 (GRCm39) missense probably damaging 0.98
IGL01631:Ednrb APN 14 104,080,661 (GRCm39) missense probably benign 0.02
IGL01696:Ednrb APN 14 104,060,625 (GRCm39) missense probably benign 0.00
IGL01974:Ednrb APN 14 104,058,254 (GRCm39) missense probably damaging 1.00
IGL02749:Ednrb APN 14 104,060,495 (GRCm39) missense possibly damaging 0.63
IGL03277:Ednrb APN 14 104,080,735 (GRCm39) missense probably benign 0.00
gus-gus UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
pongo UTSW 14 104,060,710 (GRCm39) splice site probably null
sposh UTSW 14 104,059,150 (GRCm39) missense probably damaging 0.97
R0284:Ednrb UTSW 14 104,057,449 (GRCm39) missense probably damaging 1.00
R0591:Ednrb UTSW 14 104,060,710 (GRCm39) splice site probably null
R2072:Ednrb UTSW 14 104,054,535 (GRCm39) missense probably benign 0.27
R2080:Ednrb UTSW 14 104,080,536 (GRCm39) missense probably damaging 1.00
R2102:Ednrb UTSW 14 104,058,350 (GRCm39) nonsense probably null
R2118:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2119:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2124:Ednrb UTSW 14 104,059,204 (GRCm39) missense probably benign 0.42
R2851:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R2852:Ednrb UTSW 14 104,059,110 (GRCm39) missense probably benign 0.04
R3708:Ednrb UTSW 14 104,054,516 (GRCm39) missense probably damaging 1.00
R4887:Ednrb UTSW 14 104,057,447 (GRCm39) missense possibly damaging 0.95
R5626:Ednrb UTSW 14 104,080,564 (GRCm39) missense probably damaging 0.98
R5688:Ednrb UTSW 14 104,060,831 (GRCm39) missense probably damaging 1.00
R5834:Ednrb UTSW 14 104,058,313 (GRCm39) missense probably damaging 1.00
R7212:Ednrb UTSW 14 104,080,444 (GRCm39) missense probably damaging 0.96
R7368:Ednrb UTSW 14 104,057,453 (GRCm39) missense probably benign 0.01
R7766:Ednrb UTSW 14 104,080,725 (GRCm39) missense probably benign 0.12
R7866:Ednrb UTSW 14 104,080,738 (GRCm39) missense probably benign
R8170:Ednrb UTSW 14 104,060,640 (GRCm39) missense possibly damaging 0.92
R8220:Ednrb UTSW 14 104,059,141 (GRCm39) missense probably damaging 1.00
R8299:Ednrb UTSW 14 104,060,936 (GRCm39) missense probably damaging 1.00
R8375:Ednrb UTSW 14 104,057,383 (GRCm39) missense probably damaging 1.00
R8431:Ednrb UTSW 14 104,080,633 (GRCm39) missense probably benign 0.00
R9035:Ednrb UTSW 14 104,080,665 (GRCm39) missense probably benign 0.00
R9128:Ednrb UTSW 14 104,080,528 (GRCm39) missense probably damaging 1.00
R9546:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
R9547:Ednrb UTSW 14 104,080,459 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTAGGCTAATCGAGATTCCATC -3'
(R):5'- GTAGATATGGCCCACGAAACC -3'

Sequencing Primer
(F):5'- GCTAATCGAGATTCCATCTTAAAAGG -3'
(R):5'- TAGATATGGCCCACGAAACCCTATAC -3'
Posted On 2016-12-15