Mutagenetix > Incidental Mutations

Incidental Mutation 'R5802:Ednrb'

448803

Institutional Source

Beutler Lab

Gene Symbol

Ednrb

Ensembl Gene

ENSMUSG00000022122

Gene Name

endothelin receptor type B

Synonyms

ETb, ETR-b, Sox10m1

MMRRC Submission

043391-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.747) question?

Stock #

R5802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103814625-103844402 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 103821714 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 292 (F292S)

Ref Sequence

ENSEMBL: ENSMUSP00000154806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022718] [ENSMUST00000172237] [ENSMUST00000227824]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022718
AA Change: F292S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000022718
Gene: ENSMUSG00000022122
AA Change: F292S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	109	329	2.3e-6	PFAM
Pfam:7TM_GPCR_Srsx	112	401	7.3e-11	PFAM
Pfam:7tm_1	118	387	8.5e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000172237
AA Change: F292S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126057
Gene: ENSMUSG00000022122
AA Change: F292S

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	109	328	1.9e-6	PFAM
Pfam:7TM_GPCR_Srsx	112	401	7.3e-11	PFAM
Pfam:7tm_1	118	387	4.2e-40	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000227824
AA Change: F292S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

Meta Mutation Damage Score

0.7425

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: This gene encodes a member of the G-protein coupled receptor family. It encodes a receptor for endothelins, peptides that are involved in vasocontriction. The encoded protein activates a phosphatidylinositol-calcium second messenger system and is required for the development of enteric neurons and melanocytes. Gene disruption causes pigmentation anomalies, deafness, and abnormal dilation of the colon due to defects of neural crest-derived cells. Mutations in this gene are found in the piebald mouse, and mouse models of Hirschsprung's disease and Waardenburg syndrome type 4. Renal collecting duct-specific gene deletion causes sodium retention and hypertension. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for null mutations have pigmentation limited to small patches on the head and rump and die from megacolon resulting from impaired neural crest migration and aganglionosis. Heterozygotes for a null allele show improved cardiac tolerance to hypoxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Ptpru	C	T	4: 131,788,377	E827K	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Slc6a4	C	T	11: 77,019,236	T439M	probably damaging	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tecpr1	A	T	5: 144,206,546	N670K	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trappc9	T	C	15: 72,685,339	E812G	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Xylt1	A	T	7: 117,656,691	T829S	probably benign	Het
Zc3h6	C	T	2: 129,015,559	P666L	possibly damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Ednrb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Ednrb	APN	14	103820019	missense	probably damaging	1.00
IGL01433:Ednrb	APN	14	103843190	missense	probably damaging	0.98
IGL01631:Ednrb	APN	14	103843225	missense	probably benign	0.02
IGL01696:Ednrb	APN	14	103823189	missense	probably benign	0.00
IGL01974:Ednrb	APN	14	103820818	missense	probably damaging	1.00
IGL02749:Ednrb	APN	14	103823059	missense	possibly damaging	0.63
IGL03277:Ednrb	APN	14	103843299	missense	probably benign	0.00
gus-gus	UTSW	14	103820013	missense	probably damaging	1.00
pongo	UTSW	14	103823274	splice site	probably null
sposh	UTSW	14	103821714	missense	probably damaging	0.97
R0284:Ednrb	UTSW	14	103820013	missense	probably damaging	1.00
R0591:Ednrb	UTSW	14	103823274	splice site	probably null
R2072:Ednrb	UTSW	14	103817099	missense	probably benign	0.27
R2080:Ednrb	UTSW	14	103843100	missense	probably damaging	1.00
R2102:Ednrb	UTSW	14	103820914	nonsense	probably null
R2118:Ednrb	UTSW	14	103821768	missense	probably benign	0.42
R2119:Ednrb	UTSW	14	103821768	missense	probably benign	0.42
R2124:Ednrb	UTSW	14	103821768	missense	probably benign	0.42
R2851:Ednrb	UTSW	14	103821674	missense	probably benign	0.04
R2852:Ednrb	UTSW	14	103821674	missense	probably benign	0.04
R3708:Ednrb	UTSW	14	103817080	missense	probably damaging	1.00
R4887:Ednrb	UTSW	14	103820011	missense	possibly damaging	0.95
R5626:Ednrb	UTSW	14	103843128	missense	probably damaging	0.98
R5688:Ednrb	UTSW	14	103823395	missense	probably damaging	1.00
R5834:Ednrb	UTSW	14	103820877	missense	probably damaging	1.00
R7212:Ednrb	UTSW	14	103843008	missense	probably damaging	0.96
R7368:Ednrb	UTSW	14	103820017	missense	probably benign	0.01
R7766:Ednrb	UTSW	14	103843289	missense	probably benign	0.12
R7866:Ednrb	UTSW	14	103843302	missense	probably benign
R8170:Ednrb	UTSW	14	103823204	missense	possibly damaging	0.92
R8220:Ednrb	UTSW	14	103821705	missense	probably damaging	1.00
R8299:Ednrb	UTSW	14	103823500	missense	probably damaging	1.00
R8375:Ednrb	UTSW	14	103819947	missense	probably damaging	1.00
R8431:Ednrb	UTSW	14	103843197	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCTAGGCTAATCGAGATTCCATC -3'
(R):5'- GTAGATATGGCCCACGAAACC -3'

Sequencing Primer
(F):5'- GCTAATCGAGATTCCATCTTAAAAGG -3'
(R):5'- TAGATATGGCCCACGAAACCCTATAC -3'

Posted On

2016-12-15