Incidental Mutation 'R5802:Tgds'
ID448804
Institutional Source Beutler Lab
Gene Symbol Tgds
Ensembl Gene ENSMUSG00000022130
Gene NameTDP-glucose 4,6-dehydratase
Synonyms
MMRRC Submission 043391-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R5802 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location118111911-118132755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118132707 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 8 (E8G)
Ref Sequence ENSEMBL: ENSMUSP00000153859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022727] [ENSMUST00000022728] [ENSMUST00000227350] [ENSMUST00000228543]
Predicted Effect probably benign
Transcript: ENSMUST00000022727
AA Change: E8G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022727
Gene: ENSMUSG00000022130
AA Change: E8G

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 18 333 2.9e-27 PFAM
Pfam:Epimerase 20 258 3.2e-61 PFAM
Pfam:Polysacc_synt_2 20 300 2.6e-27 PFAM
Pfam:3Beta_HSD 21 248 3.2e-29 PFAM
Pfam:GDP_Man_Dehyd 21 327 2.3e-77 PFAM
Pfam:NAD_binding_4 22 230 9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022728
SMART Domains Protein: ENSMUSP00000022728
Gene: ENSMUSG00000022131

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lung_7-TM_R 132 418 2.1e-12 PFAM
Pfam:GpcrRhopsn4 142 406 6.1e-88 PFAM
low complexity region 419 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227350
AA Change: E8G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228085
Predicted Effect probably benign
Transcript: ENSMUST00000228543
AA Change: E8G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1657 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the short-chain dehydrogenases/reductases (SDR) superfamily, and is thought to contain a nicotinamide adenine dinucleotide (NAD) binding domain. This large SDR family of enzymes is involved in the metabolism of a variety of compounds, including prostaglandins, retinoids, lipids, steroid hormones, and xenobiotics. Mutations in this gene have been associated with Catel-Manzke syndrome, which is characterized by Pierre Robin sequence, and radial deviation of the index finger due to the presence of an accessory bone between the index finger and its proximal phalanx. Pierre Robin sequence is defined by an undersized jaw, backwards displacement of the tongue base that causes an obstruction of the airways, and can also be associated with a cleft palate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 11,950,964 D383V probably damaging Het
Abca4 A T 3: 122,054,232 L67F probably damaging Het
Abcc9 C A 6: 142,656,676 probably null Het
Atp2a3 T C 11: 72,972,882 V175A probably damaging Het
B3galt4 T A 17: 33,950,757 D169V probably damaging Het
Bsn C T 9: 108,113,009 R1848Q possibly damaging Het
Camkk2 T C 5: 122,734,244 E90G probably damaging Het
Cdon T A 9: 35,454,420 I155N probably damaging Het
Cep70 A G 9: 99,296,405 N519D probably damaging Het
Clgn T C 8: 83,425,614 S582P probably damaging Het
Cnga3 T C 1: 37,260,925 F280S probably damaging Het
Dennd4c C T 4: 86,811,453 T764M probably benign Het
Dis3 A T 14: 99,099,664 S4T probably damaging Het
Dlgap1 T C 17: 70,766,091 probably null Het
Dnah17 C T 11: 118,036,446 V3839I possibly damaging Het
Dnajc1 A G 2: 18,284,739 Y286H probably benign Het
Dynap T A 18: 70,241,002 D151V unknown Het
Ednrb A G 14: 103,821,714 F292S probably damaging Het
Eef1a1 A G 9: 78,479,036 S396P probably damaging Het
Fancg A G 4: 43,006,582 F324S probably benign Het
Fbxw11 T A 11: 32,711,790 S56T probably benign Het
Gm13178 T A 4: 144,703,636 D261V probably damaging Het
Gm14409 T C 2: 177,265,256 T150A possibly damaging Het
Gm17535 G C 9: 3,035,758 V209L probably benign Homo
Gm20767 G A 13: 120,154,913 S96N possibly damaging Het
Gm5592 C T 7: 41,219,105 probably benign Het
Gm7030 A G 17: 36,111,287 probably benign Het
Gpr137 C T 19: 6,942,005 W51* probably null Het
Hbb-bs T C 7: 103,826,672 Y146C probably damaging Het
Herc1 G T 9: 66,462,878 C2982F probably damaging Het
Hnrnpa3 T A 2: 75,665,056 N309K unknown Het
Hydin A T 8: 110,452,060 I1096F possibly damaging Het
Klf12 A G 14: 100,022,894 V133A probably benign Het
Lats2 A T 14: 57,694,418 Y848N probably damaging Het
Loxl3 A G 6: 83,049,289 T453A possibly damaging Het
Ltn1 T G 16: 87,415,681 H664P probably benign Het
Lypd6 C T 2: 50,173,601 T40I probably benign Het
Nbeal1 A T 1: 60,272,221 T1817S probably benign Het
Nub1 A C 5: 24,702,441 Y350S possibly damaging Het
Pbp2 A G 6: 135,309,876 Y158H possibly damaging Het
Ptpru C T 4: 131,788,377 E827K possibly damaging Het
Rap1a A G 3: 105,745,936 Y32H probably damaging Het
Raph1 T C 1: 60,488,673 N1143S possibly damaging Het
Rbl1 T C 2: 157,161,433 T859A probably benign Het
Rom1 A G 19: 8,928,824 L117P probably damaging Het
Senp6 T C 9: 80,118,644 probably benign Het
Sirpb1c T C 3: 15,832,076 M379V probably benign Het
Slc6a4 C T 11: 77,019,236 T439M probably damaging Het
Srsf12 G T 4: 33,230,929 R141L probably damaging Het
Stk10 C T 11: 32,596,748 P335L probably benign Het
Tecpr1 A T 5: 144,206,546 N670K probably benign Het
Tmem129 A G 5: 33,657,716 S38P probably damaging Het
Trappc9 T C 15: 72,685,339 E812G probably damaging Het
Trmt10b T A 4: 45,314,236 probably benign Het
Wapl A G 14: 34,692,320 T380A probably damaging Het
Xylt1 A T 7: 117,656,691 T829S probably benign Het
Zc3h6 C T 2: 129,015,559 P666L possibly damaging Het
Zfp703 C T 8: 26,979,205 P299L probably damaging Het
Other mutations in Tgds
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Tgds APN 14 118128214 splice site probably benign
IGL01521:Tgds APN 14 118113094 missense probably damaging 1.00
IGL01928:Tgds APN 14 118116129 missense probably benign 0.04
IGL02134:Tgds APN 14 118113122 missense probably benign 0.03
IGL03353:Tgds APN 14 118127507 nonsense probably null
R0079:Tgds UTSW 14 118116235 missense possibly damaging 0.76
R2005:Tgds UTSW 14 118130656 missense possibly damaging 0.51
R2104:Tgds UTSW 14 118121737 nonsense probably null
R4676:Tgds UTSW 14 118116231 missense probably benign 0.01
R4801:Tgds UTSW 14 118117033 intron probably benign
R4992:Tgds UTSW 14 118117763 missense probably damaging 1.00
R5051:Tgds UTSW 14 118128227 missense probably damaging 1.00
R5083:Tgds UTSW 14 118116079 splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGCAAAGTCGTGGACCC -3'
(R):5'- TCTCCTAGCTGGTGACTATGGG -3'

Sequencing Primer
(F):5'- AAGTCGTGGACCCGAAGTGC -3'
(R):5'- CTATGGGCTAGAGAGTGCGC -3'
Posted On2016-12-15