Mutagenetix > Incidental Mutation

Incidental Mutation 'R5802:Trappc9'

448805

Institutional Source

Beutler Lab

Gene Symbol

Trappc9

Ensembl Gene

ENSMUSG00000047921

Gene Name

trafficking protein particle complex 9

Synonyms

TRS130, Nibp, 2900005P22Rik, 4632408O18Rik, 1810044A24Rik

MMRRC Submission

043391-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5802 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72589620-73061204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72685339 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 812 (E812G)

Ref Sequence

ENSEMBL: ENSMUSP00000023276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023276] [ENSMUST00000089770]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000023276
AA Change: E812G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000023276
Gene: ENSMUSG00000047921
AA Change: E812G

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	2	920	3.6e-239	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000089770
AA Change: E991G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000087202
Gene: ENSMUSG00000047921
AA Change: E991G

Domain	Start	End	E-Value	Type
Pfam:TRAPPC9-Trs120	182	350	4.1e-20	PFAM
Pfam:TRAPPC9-Trs120	434	664	2.2e-16	PFAM
low complexity region	993	1004	N/A	INTRINSIC

Meta Mutation Damage Score

0.4208

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	A	T	1: 11,950,964	D383V	probably damaging	Het
Abca4	A	T	3: 122,054,232	L67F	probably damaging	Het
Abcc9	C	A	6: 142,656,676		probably null	Het
Atp2a3	T	C	11: 72,972,882	V175A	probably damaging	Het
B3galt4	T	A	17: 33,950,757	D169V	probably damaging	Het
Bsn	C	T	9: 108,113,009	R1848Q	possibly damaging	Het
Camkk2	T	C	5: 122,734,244	E90G	probably damaging	Het
Cdon	T	A	9: 35,454,420	I155N	probably damaging	Het
Cep70	A	G	9: 99,296,405	N519D	probably damaging	Het
Clgn	T	C	8: 83,425,614	S582P	probably damaging	Het
Cnga3	T	C	1: 37,260,925	F280S	probably damaging	Het
Dennd4c	C	T	4: 86,811,453	T764M	probably benign	Het
Dis3	A	T	14: 99,099,664	S4T	probably damaging	Het
Dlgap1	T	C	17: 70,766,091		probably null	Het
Dnah17	C	T	11: 118,036,446	V3839I	possibly damaging	Het
Dnajc1	A	G	2: 18,284,739	Y286H	probably benign	Het
Dynap	T	A	18: 70,241,002	D151V	unknown	Het
Ednrb	A	G	14: 103,821,714	F292S	probably damaging	Het
Eef1a1	A	G	9: 78,479,036	S396P	probably damaging	Het
Fancg	A	G	4: 43,006,582	F324S	probably benign	Het
Fbxw11	T	A	11: 32,711,790	S56T	probably benign	Het
Gm13178	T	A	4: 144,703,636	D261V	probably damaging	Het
Gm14409	T	C	2: 177,265,256	T150A	possibly damaging	Het
Gm17535	G	C	9: 3,035,758	V209L	probably benign	Homo
Gm20767	G	A	13: 120,154,913	S96N	possibly damaging	Het
Gm5592	C	T	7: 41,219,105		probably benign	Het
Gm7030	A	G	17: 36,111,287		probably benign	Het
Gpr137	C	T	19: 6,942,005	W51*	probably null	Het
Hbb-bs	T	C	7: 103,826,672	Y146C	probably damaging	Het
Herc1	G	T	9: 66,462,878	C2982F	probably damaging	Het
Hnrnpa3	T	A	2: 75,665,056	N309K	unknown	Het
Hydin	A	T	8: 110,452,060	I1096F	possibly damaging	Het
Klf12	A	G	14: 100,022,894	V133A	probably benign	Het
Lats2	A	T	14: 57,694,418	Y848N	probably damaging	Het
Loxl3	A	G	6: 83,049,289	T453A	possibly damaging	Het
Ltn1	T	G	16: 87,415,681	H664P	probably benign	Het
Lypd6	C	T	2: 50,173,601	T40I	probably benign	Het
Nbeal1	A	T	1: 60,272,221	T1817S	probably benign	Het
Nub1	A	C	5: 24,702,441	Y350S	possibly damaging	Het
Pbp2	A	G	6: 135,309,876	Y158H	possibly damaging	Het
Ptpru	C	T	4: 131,788,377	E827K	possibly damaging	Het
Rap1a	A	G	3: 105,745,936	Y32H	probably damaging	Het
Raph1	T	C	1: 60,488,673	N1143S	possibly damaging	Het
Rbl1	T	C	2: 157,161,433	T859A	probably benign	Het
Rom1	A	G	19: 8,928,824	L117P	probably damaging	Het
Senp6	T	C	9: 80,118,644		probably benign	Het
Sirpb1c	T	C	3: 15,832,076	M379V	probably benign	Het
Slc6a4	C	T	11: 77,019,236	T439M	probably damaging	Het
Srsf12	G	T	4: 33,230,929	R141L	probably damaging	Het
Stk10	C	T	11: 32,596,748	P335L	probably benign	Het
Tecpr1	A	T	5: 144,206,546	N670K	probably benign	Het
Tgds	T	C	14: 118,132,707	E8G	probably benign	Het
Tmem129	A	G	5: 33,657,716	S38P	probably damaging	Het
Trmt10b	T	A	4: 45,314,236		probably benign	Het
Wapl	A	G	14: 34,692,320	T380A	probably damaging	Het
Xylt1	A	T	7: 117,656,691	T829S	probably benign	Het
Zc3h6	C	T	2: 129,015,559	P666L	possibly damaging	Het
Zfp703	C	T	8: 26,979,205	P299L	probably damaging	Het

Other mutations in Trappc9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Trappc9	APN	15	73026026	missense	possibly damaging	0.79
IGL01348:Trappc9	APN	15	72937009	missense	possibly damaging	0.64
IGL01367:Trappc9	APN	15	72590153	missense	probably benign	0.31
IGL01521:Trappc9	APN	15	73052167	missense	probably damaging	1.00
IGL01726:Trappc9	APN	15	72946122	missense	probably damaging	0.98
IGL01881:Trappc9	APN	15	72999992	missense	probably damaging	1.00
IGL02214:Trappc9	APN	15	73012882	nonsense	probably null
IGL02693:Trappc9	APN	15	72963693	splice site	probably benign
IGL03229:Trappc9	APN	15	73058456	missense	probably damaging	1.00
basilio	UTSW	15	73058393	missense	probably damaging	1.00
Boomboom	UTSW	15	72736869	nonsense	probably null
bronto	UTSW	15	73058238	nonsense	probably null
Earl	UTSW	15	72736777	nonsense	probably null
Sotto_aceto	UTSW	15	72685339	missense	probably damaging	0.99
P0026:Trappc9	UTSW	15	72953082	missense	probably damaging	1.00
PIT4453001:Trappc9	UTSW	15	73031598	frame shift	probably null
PIT4519001:Trappc9	UTSW	15	72953094	missense	probably benign
R0001:Trappc9	UTSW	15	72963662	missense	probably damaging	1.00
R0094:Trappc9	UTSW	15	72894929	intron	probably benign
R0745:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0747:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0800:Trappc9	UTSW	15	72953132	splice site	probably benign
R0816:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0819:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0820:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R0893:Trappc9	UTSW	15	72590107	missense	probably damaging	1.00
R0976:Trappc9	UTSW	15	72999974	missense	probably damaging	0.99
R1119:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1266:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1453:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1454:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1531:Trappc9	UTSW	15	72693548	nonsense	probably null
R1543:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1563:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1565:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1600:Trappc9	UTSW	15	72937109	nonsense	probably null
R1712:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1756:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1789:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R1978:Trappc9	UTSW	15	73000025	missense	probably damaging	1.00
R2001:Trappc9	UTSW	15	73058036	missense	probably damaging	0.99
R2312:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2334:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R2926:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3123:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3124:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3125:Trappc9	UTSW	15	73025967	missense	probably damaging	1.00
R3813:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R4012:Trappc9	UTSW	15	73031623	missense	possibly damaging	0.95
R4080:Trappc9	UTSW	15	72941947	missense	probably damaging	1.00
R4282:Trappc9	UTSW	15	72590792	missense	probably damaging	1.00
R4572:Trappc9	UTSW	15	72937067	missense	possibly damaging	0.61
R4739:Trappc9	UTSW	15	72937060	missense	probably damaging	0.97
R4959:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R4973:Trappc9	UTSW	15	72937056	missense	probably damaging	1.00
R5123:Trappc9	UTSW	15	72913366	intron	probably benign
R5128:Trappc9	UTSW	15	73058393	missense	probably damaging	1.00
R5228:Trappc9	UTSW	15	73057995	missense	probably damaging	1.00
R5362:Trappc9	UTSW	15	73058217	missense	possibly damaging	0.68
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6032:Trappc9	UTSW	15	72925530	missense	probably benign	0.43
R6154:Trappc9	UTSW	15	73058081	missense	probably benign	0.03
R6372:Trappc9	UTSW	15	72590074	missense	possibly damaging	0.75
R6661:Trappc9	UTSW	15	72590144	missense	possibly damaging	0.55
R6864:Trappc9	UTSW	15	72937162	splice site	probably null
R6893:Trappc9	UTSW	15	72925650	missense	possibly damaging	0.93
R7099:Trappc9	UTSW	15	72693619	missense	probably benign	0.00
R7276:Trappc9	UTSW	15	73052270	missense	probably damaging	0.99
R7349:Trappc9	UTSW	15	72736869	nonsense	probably null
R8260:Trappc9	UTSW	15	72941909	nonsense	probably null
R8399:Trappc9	UTSW	15	73052282	missense	probably damaging	1.00
R8683:Trappc9	UTSW	15	73012815	missense	probably benign	0.26
R8839:Trappc9	UTSW	15	73058238	nonsense	probably null
R8945:Trappc9	UTSW	15	73058096	missense	probably benign
R9083:Trappc9	UTSW	15	72736777	nonsense	probably null
R9323:Trappc9	UTSW	15	72693582	missense	probably benign	0.41
R9329:Trappc9	UTSW	15	72801353	missense	unknown
R9366:Trappc9	UTSW	15	72937088	missense	probably benign
R9723:Trappc9	UTSW	15	72590114	missense	possibly damaging	0.87
RF008:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF009:Trappc9	UTSW	15	72801287	small insertion	probably benign
RF014:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF016:Trappc9	UTSW	15	72801289	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801324	small insertion	probably benign
RF023:Trappc9	UTSW	15	72801331	small insertion	probably benign
RF028:Trappc9	UTSW	15	72801290	small insertion	probably benign
RF029:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF030:Trappc9	UTSW	15	72801325	small insertion	probably benign
RF034:Trappc9	UTSW	15	72801298	small insertion	probably benign
RF036:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF038:Trappc9	UTSW	15	72801323	small insertion	probably benign
RF040:Trappc9	UTSW	15	72801292	small insertion	probably benign
RF042:Trappc9	UTSW	15	72801283	small insertion	probably benign
RF043:Trappc9	UTSW	15	72801305	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801301	small insertion	probably benign
RF049:Trappc9	UTSW	15	72801306	small insertion	probably benign
RF053:Trappc9	UTSW	15	72801328	small insertion	probably benign
RF057:Trappc9	UTSW	15	72801295	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801320	small insertion	probably benign
RF063:Trappc9	UTSW	15	72801324	small insertion	probably benign
Z1177:Trappc9	UTSW	15	73052162	missense	probably null	0.51

Predicted Primers

PCR Primer
(F):5'- CAATTGCCATTTAAGAGGAGGG -3'
(R):5'- GACTACCACTCGAGCAAAGG -3'

Sequencing Primer
(F):5'- AGACCTAGCCGTGGTACTGAG -3'
(R):5'- TCGAGCAAAGGAATGATCTACC -3'

Posted On

2016-12-15