Incidental Mutation 'R5802:B3galt4'
ID 448807
Institutional Source Beutler Lab
Gene Symbol B3galt4
Ensembl Gene ENSMUSG00000067370
Gene Name UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4
Synonyms Gal-T2
MMRRC Submission 043391-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R5802 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 34168886-34170462 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34169731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 169 (D169V)
Ref Sequence ENSEMBL: ENSMUSP00000084823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008812] [ENSMUST00000025170] [ENSMUST00000087543] [ENSMUST00000174609]
AlphaFold Q9Z0F0
Predicted Effect probably benign
Transcript: ENSMUST00000008812
SMART Domains Protein: ENSMUSP00000008812
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 142 2.2e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000087543
AA Change: D169V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084823
Gene: ENSMUSG00000067370
AA Change: D169V

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:Galactosyl_T 85 302 1.3e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174175
Predicted Effect probably benign
Transcript: ENSMUST00000174609
SMART Domains Protein: ENSMUSP00000138296
Gene: ENSMUSG00000008668

DomainStartEndE-ValueType
Pfam:Ribosomal_S13 14 107 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174745
Meta Mutation Damage Score 0.9383 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the beta-1,3-galactosyltransferase (beta3GalT) gene family. This family encodes type II membrane-bound glycoproteins with diverse enzymatic functions using different donor substrates (UDP-galactose and UDP-N-acetylglucosamine) and different acceptor sugars (N-acetylglucosamine, galactose, N-acetylgalactosamine). The beta3GalT genes are distantly related to the Drosophila Brainiac gene and have the protein coding sequence contained in a single exon. The beta3GalT proteins also contain conserved sequences not found in the beta4GalT or alpha3GalT proteins. The carbohydrate chains synthesized by these enzymes are designated as type 1, whereas beta4GalT enzymes synthesize type 2 carbohydrate chains. The ratio of type 1:type 2 chains changes during embryogenesis. By sequence similarity, the beta3GalT genes fall into at least two groups: beta3GalT4 and 4 other beta3GalT genes (beta3GalT1-3, beta3GalT5). This gene is oriented telomere to centromere in close proximity to the ribosomal protein S18 gene. The functionality of the encoded protein is limited to ganglioseries glycolipid biosynthesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik A T 1: 12,021,188 (GRCm39) D383V probably damaging Het
AAdacl4fm3 T A 4: 144,430,206 (GRCm39) D261V probably damaging Het
Abca4 A T 3: 121,847,881 (GRCm39) L67F probably damaging Het
Abcc9 C A 6: 142,602,402 (GRCm39) probably null Het
Atp2a3 T C 11: 72,863,708 (GRCm39) V175A probably damaging Het
Bsn C T 9: 107,990,208 (GRCm39) R1848Q possibly damaging Het
Camkk2 T C 5: 122,872,307 (GRCm39) E90G probably damaging Het
Cdon T A 9: 35,365,716 (GRCm39) I155N probably damaging Het
Cep70 A G 9: 99,178,458 (GRCm39) N519D probably damaging Het
Clgn T C 8: 84,152,243 (GRCm39) S582P probably damaging Het
Cnga3 T C 1: 37,300,006 (GRCm39) F280S probably damaging Het
Dennd4c C T 4: 86,729,690 (GRCm39) T764M probably benign Het
Dis3 A T 14: 99,337,100 (GRCm39) S4T probably damaging Het
Dlgap1 T C 17: 71,073,086 (GRCm39) probably null Het
Dnah17 C T 11: 117,927,272 (GRCm39) V3839I possibly damaging Het
Dnajc1 A G 2: 18,289,550 (GRCm39) Y286H probably benign Het
Dynap T A 18: 70,374,073 (GRCm39) D151V unknown Het
Ednrb A G 14: 104,059,150 (GRCm39) F292S probably damaging Het
Eef1a1 A G 9: 78,386,318 (GRCm39) S396P probably damaging Het
Fancg A G 4: 43,006,582 (GRCm39) F324S probably benign Het
Fbxw11 T A 11: 32,661,790 (GRCm39) S56T probably benign Het
Gm17535 G C 9: 3,035,758 (GRCm39) V209L probably benign Homo
Gm5592 C T 7: 40,868,529 (GRCm39) probably benign Het
Gpr137 C T 19: 6,919,373 (GRCm39) W51* probably null Het
H2-T9 A G 17: 36,422,179 (GRCm39) probably benign Het
Hbb-bs T C 7: 103,475,879 (GRCm39) Y146C probably damaging Het
Herc1 G T 9: 66,370,160 (GRCm39) C2982F probably damaging Het
Hnrnpa3 T A 2: 75,495,400 (GRCm39) N309K unknown Het
Hydin A T 8: 111,178,692 (GRCm39) I1096F possibly damaging Het
Klf12 A G 14: 100,260,330 (GRCm39) V133A probably benign Het
Lats2 A T 14: 57,931,875 (GRCm39) Y848N probably damaging Het
Loxl3 A G 6: 83,026,270 (GRCm39) T453A possibly damaging Het
Ltn1 T G 16: 87,212,569 (GRCm39) H664P probably benign Het
Lypd6 C T 2: 50,063,613 (GRCm39) T40I probably benign Het
Nbeal1 A T 1: 60,311,380 (GRCm39) T1817S probably benign Het
Nub1 A C 5: 24,907,439 (GRCm39) Y350S possibly damaging Het
Pbp2 A G 6: 135,286,874 (GRCm39) Y158H possibly damaging Het
Ptpru C T 4: 131,515,688 (GRCm39) E827K possibly damaging Het
Rap1a A G 3: 105,653,252 (GRCm39) Y32H probably damaging Het
Raph1 T C 1: 60,527,832 (GRCm39) N1143S possibly damaging Het
Rbl1 T C 2: 157,003,353 (GRCm39) T859A probably benign Het
Rom1 A G 19: 8,906,188 (GRCm39) L117P probably damaging Het
Senp6 T C 9: 80,025,926 (GRCm39) probably benign Het
Sirpb1c T C 3: 15,886,240 (GRCm39) M379V probably benign Het
Slc6a4 C T 11: 76,910,062 (GRCm39) T439M probably damaging Het
Srsf12 G T 4: 33,230,929 (GRCm39) R141L probably damaging Het
Stk10 C T 11: 32,546,748 (GRCm39) P335L probably benign Het
Tcstv2c G A 13: 120,616,449 (GRCm39) S96N possibly damaging Het
Tecpr1 A T 5: 144,143,364 (GRCm39) N670K probably benign Het
Tgds T C 14: 118,370,119 (GRCm39) E8G probably benign Het
Tmem129 A G 5: 33,815,060 (GRCm39) S38P probably damaging Het
Trappc9 T C 15: 72,557,188 (GRCm39) E812G probably damaging Het
Trmt10b T A 4: 45,314,236 (GRCm39) probably benign Het
Wapl A G 14: 34,414,277 (GRCm39) T380A probably damaging Het
Xylt1 A T 7: 117,255,914 (GRCm39) T829S probably benign Het
Zc3h6 C T 2: 128,857,479 (GRCm39) P666L possibly damaging Het
Zfp1010 T C 2: 176,957,049 (GRCm39) T150A possibly damaging Het
Zfp703 C T 8: 27,469,233 (GRCm39) P299L probably damaging Het
Other mutations in B3galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01545:B3galt4 APN 17 34,170,187 (GRCm39) missense probably benign 0.23
IGL02216:B3galt4 APN 17 34,169,539 (GRCm39) missense probably damaging 1.00
beacon UTSW 17 34,169,819 (GRCm39) missense probably damaging 1.00
beguiling UTSW 17 34,169,821 (GRCm39) missense probably damaging 1.00
R0326:B3galt4 UTSW 17 34,169,722 (GRCm39) missense probably damaging 1.00
R0419:B3galt4 UTSW 17 34,169,764 (GRCm39) missense probably damaging 1.00
R0446:B3galt4 UTSW 17 34,169,992 (GRCm39) missense probably benign 0.00
R1024:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1028:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1412:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1590:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1591:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R1681:B3galt4 UTSW 17 34,170,187 (GRCm39) missense probably benign 0.23
R1851:B3galt4 UTSW 17 34,169,885 (GRCm39) missense probably benign 0.26
R1955:B3galt4 UTSW 17 34,169,606 (GRCm39) nonsense probably null
R2103:B3galt4 UTSW 17 34,169,813 (GRCm39) missense probably damaging 1.00
R6922:B3galt4 UTSW 17 34,169,821 (GRCm39) missense probably damaging 1.00
R7644:B3galt4 UTSW 17 34,169,419 (GRCm39) missense probably damaging 0.99
R8073:B3galt4 UTSW 17 34,169,797 (GRCm39) missense probably damaging 1.00
R8687:B3galt4 UTSW 17 34,169,819 (GRCm39) missense probably damaging 1.00
R8839:B3galt4 UTSW 17 34,169,867 (GRCm39) missense possibly damaging 0.89
R9200:B3galt4 UTSW 17 34,170,384 (GRCm39) unclassified probably benign
Z1177:B3galt4 UTSW 17 34,170,110 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTTCTGACACATGGTGCC -3'
(R):5'- CCTCCTGGGAAAACCTAGAAG -3'

Sequencing Primer
(F):5'- TGTCCGAGTGGGTCTCAC -3'
(R):5'- CCTAGAAGACAGCAGCTTGC -3'
Posted On 2016-12-15