Mutagenetix > Incidental Mutations

Incidental Mutation 'R5808:Ubr1'

448821

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.733) question?

Stock #

R5808 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 120961092 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 137 (R137H)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028728
AA Change: R137H

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: R137H

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138824

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	C	T	10: 76,450,648	R6W	probably damaging	Het
9130019O22Rik	A	T	7: 127,384,913		probably benign	Het
Ahnak	T	A	19: 9,010,235	V2961E	possibly damaging	Het
Aldh1a7	A	T	19: 20,708,197	Y330N	possibly damaging	Het
Bag6	A	G	17: 35,146,322	Y1041C	probably damaging	Het
Baz1b	T	A	5: 135,221,958	V866E	probably benign	Het
Bmpr2	A	T	1: 59,867,401	Y551F	probably benign	Het
Cage1	A	G	13: 38,022,325		probably benign	Het
Caskin2	G	T	11: 115,801,763	P732Q	probably damaging	Het
Cbfa2t2	T	C	2: 154,517,826		probably null	Het
Ccdc162	A	T	10: 41,655,504	M502K	possibly damaging	Het
Cfap157	T	C	2: 32,780,645	D197G	probably damaging	Het
CN725425	T	A	15: 91,245,644	S237T	probably benign	Het
Defb40	T	C	8: 18,975,079	H37R	probably benign	Het
Dis3l2	A	C	1: 87,049,638	S836R	possibly damaging	Het
Dnah14	T	C	1: 181,741,159	I2818T	possibly damaging	Het
Dpysl2	T	A	14: 66,865,172		probably null	Het
Dsc1	A	T	18: 20,086,829	C761*	probably null	Het
Dsg1b	A	T	18: 20,408,725	D763V	probably damaging	Het
Eif2ak1	C	T	5: 143,883,994	P251L	probably benign	Het
Epha6	A	T	16: 59,682,742	I934K	probably damaging	Het
Fbxo40	T	C	16: 36,970,382	E122G	probably damaging	Het
Filip1	C	T	9: 79,818,701	G879R	possibly damaging	Het
Frem2	A	T	3: 53,652,563	F1508I	probably damaging	Het
Gja1	A	G	10: 56,388,498	N318D	probably benign	Het
Gm11564	T	C	11: 99,815,041	S188G	unknown	Het
Hlcs	A	G	16: 94,262,632	V523A	probably benign	Het
Kif1a	C	A	1: 93,042,698	E1041D	probably damaging	Het
Lamtor1	A	G	7: 101,910,082	Y81C	possibly damaging	Het
Loxl1	A	G	9: 58,294,449	L453S	probably damaging	Het
Mcf2l	A	G	8: 12,993,937	M1V	probably null	Het
Megf6	A	G	4: 154,267,662	Q1208R	probably benign	Het
Morc2a	T	A	11: 3,683,781	I631N	probably benign	Het
Muc6	T	C	7: 141,640,093		probably benign	Het
Mybpc1	T	C	10: 88,570,566	S139G	possibly damaging	Het
Myo18a	T	C	11: 77,829,301	F1017L	probably benign	Het
Nup62	A	C	7: 44,829,992	Q477P	possibly damaging	Het
P2ry13	T	A	3: 59,210,232	I42F	probably benign	Het
Ptprb	G	A	10: 116,339,487	R1129K	probably benign	Het
Rexo4	T	A	2: 26,964,185	K45I	probably damaging	Het
Rnf213	G	A	11: 119,436,295	V1703I	probably benign	Het
Sec23ip	C	A	7: 128,772,184	A710E	probably benign	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slc41a2	T	C	10: 83,313,498	T194A	probably benign	Het
Slc4a10	G	A	2: 62,250,472	A348T	probably damaging	Het
Soat2	G	A	15: 102,154,025		probably null	Het
Srms	T	C	2: 181,208,755	S204G	probably benign	Het
Szt2	G	A	4: 118,372,613	R2774C	unknown	Het
Tcf7l2	T	C	19: 55,908,541	V182A	probably damaging	Het
Tmem167b	C	T	3: 108,560,243	R29H	probably benign	Het
Trappc12	T	A	12: 28,746,864	D223V	probably damaging	Het
Ttc6	T	A	12: 57,617,611	S383R	possibly damaging	Het
Vmn2r24	T	A	6: 123,815,638	C641*	probably null	Het
Vrk3	A	G	7: 44,759,874	D155G	probably damaging	Het
Xxylt1	T	C	16: 31,050,685	Y199C	probably damaging	Het
Zbtb46	A	T	2: 181,423,570	D262E	probably benign	Het
Zcchc9	A	T	13: 91,800,647	S58T	probably benign	Het
Zfyve16	A	T	13: 92,495,055	L1344*	probably null	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	synonymous	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	intron	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GAGGGTCAAATCTTCCAAGAATGTAG -3'
(R):5'- ACTCAGCTTTTGGGGCATCC -3'

Sequencing Primer
(F):5'- ATCTTCCAAGAATGTAGGAAAATGG -3'
(R):5'- GGCATCCGGTGTTATTTTGCCC -3'

Posted On

2016-12-15