Incidental Mutation 'R5808:Cbfa2t2'
ID448822
Institutional Source Beutler Lab
Gene Symbol Cbfa2t2
Ensembl Gene ENSMUSG00000038533
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)
SynonymsCbfa2t2h, MTGR1, C330013D05Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.704) question?
Stock #R5808 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154436481-154539356 bp(+) (GRCm38)
Type of Mutationsplice site (2 bp from exon)
DNA Base Change (assembly) T to C at 154517826 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109724] [ENSMUST00000109725]
Predicted Effect silent
Transcript: ENSMUST00000045270
SMART Domains Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1.3e-40 PFAM
PDB:2KYG|C 420 450 3e-7 PDB
Pfam:zf-MYND 498 534 1.4e-9 PFAM
low complexity region 573 588 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000099178
SMART Domains Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 4.4e-40 PFAM
low complexity region 402 419 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109724
SMART Domains Protein: ENSMUSP00000105346
Gene: ENSMUSG00000038533

DomainStartEndE-ValueType
TAFH 58 148 1.06e-49 SMART
Predicted Effect silent
Transcript: ENSMUST00000109725
SMART Domains Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1e-40 PFAM
Pfam:zf-MYND 497 533 3.3e-11 PFAM
low complexity region 572 587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135647
Predicted Effect probably benign
Transcript: ENSMUST00000137526
SMART Domains Protein: ENSMUSP00000118371
Gene: ENSMUSG00000038533

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:NHR2 28 94 2e-41 PFAM
Pfam:zf-MYND 203 239 3.1e-10 PFAM
low complexity region 278 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Cbfa2t2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cbfa2t2 APN 2 154528875 missense probably damaging 1.00
IGL01913:Cbfa2t2 APN 2 154517773 missense probably damaging 1.00
IGL02090:Cbfa2t2 APN 2 154531416 splice site probably benign
IGL02850:Cbfa2t2 APN 2 154535170 missense probably damaging 0.97
R0302:Cbfa2t2 UTSW 2 154534876 splice site probably benign
R0356:Cbfa2t2 UTSW 2 154531349 missense probably benign 0.03
R1218:Cbfa2t2 UTSW 2 154523919 missense probably benign 0.43
R1571:Cbfa2t2 UTSW 2 154500427 missense probably damaging 1.00
R1998:Cbfa2t2 UTSW 2 154504789 missense probably damaging 1.00
R2016:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2017:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2056:Cbfa2t2 UTSW 2 154535157 missense probably damaging 1.00
R3617:Cbfa2t2 UTSW 2 154436984 intron probably benign
R4299:Cbfa2t2 UTSW 2 154523928 missense probably damaging 1.00
R4746:Cbfa2t2 UTSW 2 154523925 missense possibly damaging 0.94
R4969:Cbfa2t2 UTSW 2 154523980 missense probably damaging 1.00
R5058:Cbfa2t2 UTSW 2 154504745 missense probably damaging 1.00
R5109:Cbfa2t2 UTSW 2 154531373 missense probably damaging 1.00
R5381:Cbfa2t2 UTSW 2 154523929 missense probably damaging 1.00
R5573:Cbfa2t2 UTSW 2 154436862 intron probably benign
R5826:Cbfa2t2 UTSW 2 154500455 missense possibly damaging 0.90
R5977:Cbfa2t2 UTSW 2 154517777 missense probably damaging 1.00
R6052:Cbfa2t2 UTSW 2 154510581 missense probably damaging 1.00
R6842:Cbfa2t2 UTSW 2 154524045 missense probably benign 0.02
R6923:Cbfa2t2 UTSW 2 154534983 missense probably damaging 1.00
R7269:Cbfa2t2 UTSW 2 154515975 missense probably benign 0.37
R7318:Cbfa2t2 UTSW 2 154500454 missense probably benign 0.01
R7622:Cbfa2t2 UTSW 2 154500445 missense possibly damaging 0.90
R8030:Cbfa2t2 UTSW 2 154515896 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACTCTGGGAAGAAACAGCTATTC -3'
(R):5'- AGTCTGTGAACTCCCTCCAG -3'

Sequencing Primer
(F):5'- ACAGCTATTCTGAGACTCGTAGG -3'
(R):5'- GTCTGTGAACTCCCTCCAGATGAAG -3'
Posted On2016-12-15