Incidental Mutation 'R5808:Megf6'
ID448830
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5808 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154267662 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1208 (Q1208R)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably benign
Transcript: ENSMUST00000030897
AA Change: Q1208R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: Q1208R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127088
Predicted Effect probably benign
Transcript: ENSMUST00000128700
SMART Domains Protein: ENSMUSP00000117277
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
EGF_Lam 3 42 3.1e-2 SMART
EGF 32 73 7.53e-1 SMART
EGF_like 46 85 8.92e-1 SMART
EGF 84 116 7.13e-2 SMART
EGF 127 159 1.73e0 SMART
EGF 170 202 6.55e-1 SMART
EGF 213 245 4.39e-2 SMART
EGF_Lam 261 300 7.64e-2 SMART
EGF 299 331 1.51e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142110
Predicted Effect probably benign
Transcript: ENSMUST00000152159
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
R8175:Megf6 UTSW 4 154268619 nonsense probably null
R8231:Megf6 UTSW 4 154252518 missense not run
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGCTCCGTTCCCAGAAAG -3'
(R):5'- TTACATACCAGAATGGCAGACAG -3'

Sequencing Primer
(F):5'- GCTCCGTTCCCAGAAAGCTTAC -3'
(R):5'- GAATGGCAGACAGAACCCCAG -3'
Posted On2016-12-15