Incidental Mutation 'R5808:Loxl1'
ID448843
Institutional Source Beutler Lab
Gene Symbol Loxl1
Ensembl Gene ENSMUSG00000032334
Gene Namelysyl oxidase-like 1
SynonymsLOXL
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5808 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location58287738-58313186 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58294449 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 453 (L453S)
Ref Sequence ENSEMBL: ENSMUSP00000057406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061799]
Predicted Effect probably damaging
Transcript: ENSMUST00000061799
AA Change: L453S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057406
Gene: ENSMUSG00000032334
AA Change: L453S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 82 96 N/A INTRINSIC
low complexity region 154 165 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 202 225 N/A INTRINSIC
low complexity region 232 253 N/A INTRINSIC
low complexity region 264 280 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
Pfam:Lysyl_oxidase 403 604 5.1e-98 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the lysyl oxidase family of copper-dependent enzymes that catalyze the formation of lysine-derived crosslinks in proteins such as collagen and elastin. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional enzyme. Mice lacking the encoded protein fail to deposit normal elastic fibers in the uterine tract post partum and develop pelvic organ prolapse, enlarged airspaces of the lung, loose skin and vascular abnormalities with concomitant tropoelastin accumulation. [provided by RefSeq, Sep 2016]
PHENOTYPE: Elastic fiber homeostasis is disrupted in homozygous mutant mice, resulting in loose skin, abnormal lung morphology, intestinal defects, and post partum uterine prolapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Loxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01371:Loxl1 APN 9 58294422 missense possibly damaging 0.89
IGL02549:Loxl1 APN 9 58293638 missense probably damaging 1.00
IGL02562:Loxl1 APN 9 58288916 missense probably damaging 1.00
IGL03062:Loxl1 APN 9 58311910 missense possibly damaging 0.61
R0141:Loxl1 UTSW 9 58312132 missense probably damaging 0.98
R1503:Loxl1 UTSW 9 58293640 missense probably damaging 1.00
R1898:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R2125:Loxl1 UTSW 9 58293712 missense probably damaging 1.00
R2264:Loxl1 UTSW 9 58297678 missense probably damaging 1.00
R4094:Loxl1 UTSW 9 58312456 missense probably damaging 0.98
R4993:Loxl1 UTSW 9 58312537 missense probably damaging 0.99
R5484:Loxl1 UTSW 9 58290782 missense possibly damaging 0.75
R5598:Loxl1 UTSW 9 58312367 missense possibly damaging 0.71
R5917:Loxl1 UTSW 9 58312723 missense probably damaging 1.00
R7566:Loxl1 UTSW 9 58312198 missense probably damaging 0.98
R7899:Loxl1 UTSW 9 58290834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGCTTTGCTAAGGGTCCC -3'
(R):5'- GTCATGCAGAGATCAAATGTCC -3'

Sequencing Primer
(F):5'- AAGCACCTGAGTTTCCCAGG -3'
(R):5'- TGCAGAGATCAAATGTCCAAGATC -3'
Posted On2016-12-15