Incidental Mutation 'R5808:Gja1'
ID448846
Institutional Source Beutler Lab
Gene Symbol Gja1
Ensembl Gene ENSMUSG00000050953
Gene Namegap junction protein, alpha 1
Synonymsconnexin43, Cx43alpha1, Gja-1, alpha 1 connexin, connexin 43, Cx43
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5808 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location56377330-56402513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56388498 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 318 (N318D)
Ref Sequence ENSEMBL: ENSMUSP00000151620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068581] [ENSMUST00000217789] [ENSMUST00000218444] [ENSMUST00000218834] [ENSMUST00000220069] [ENSMUST00000220194]
Predicted Effect probably benign
Transcript: ENSMUST00000068581
AA Change: N318D

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064536
Gene: ENSMUSG00000050953
AA Change: N318D

DomainStartEndE-ValueType
CNX 43 76 5.34e-20 SMART
low complexity region 102 114 N/A INTRINSIC
Connexin_CCC 165 231 5.06e-39 SMART
Pfam:Connexin43 293 312 5e-14 PFAM
low complexity region 362 377 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217789
Predicted Effect probably benign
Transcript: ENSMUST00000218444
Predicted Effect probably benign
Transcript: ENSMUST00000218834
Predicted Effect probably benign
Transcript: ENSMUST00000220069
AA Change: N318D

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000220194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220204
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the connexin gene family. The encoded protein is a component of gap junctions, which are composed of arrays of intercellular channels that provide a route for the diffusion of low molecular weight materials from cell to cell. The encoded protein is the major protein of gap junctions in the heart that are thought to have a crucial role in the synchronized contraction of the heart and in embryonic development. A related intronless pseudogene has been mapped to chromosome 5. Mutations in this gene have been associated with oculodentodigital dysplasia, autosomal recessive craniometaphyseal dysplasia and heart malformations. [provided by RefSeq, May 2014]
PHENOTYPE: Mutant homozygotes are neonatal lethal with heart and outflow tract malformations, eye lens anomalies, and male germ cell deficiency. Conditional deletion in ovary affects follicular development, in astrocytes enhances locomotor activity, and in neural cells produces behavioral and neural defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Gja1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Gja1 APN 10 56388322 missense probably benign 0.03
IGL01660:Gja1 APN 10 56388448 missense probably damaging 1.00
IGL02387:Gja1 APN 10 56387806 missense possibly damaging 0.48
IGL02596:Gja1 APN 10 56388252 missense possibly damaging 0.77
R0607:Gja1 UTSW 10 56388070 missense possibly damaging 0.58
R1386:Gja1 UTSW 10 56387969 missense probably benign 0.01
R4084:Gja1 UTSW 10 56388511 missense possibly damaging 0.70
R4542:Gja1 UTSW 10 56388052 missense probably damaging 1.00
R4601:Gja1 UTSW 10 56388229 missense probably damaging 1.00
R5061:Gja1 UTSW 10 56387656 missense probably damaging 1.00
R5301:Gja1 UTSW 10 56388379 missense probably damaging 0.96
R5740:Gja1 UTSW 10 56388189 missense probably damaging 0.99
R6120:Gja1 UTSW 10 56388505 missense probably benign 0.00
R6192:Gja1 UTSW 10 56388234 missense probably damaging 1.00
R7057:Gja1 UTSW 10 56388033 missense probably benign 0.30
R7227:Gja1 UTSW 10 56387656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCGGATCTCCAAAATATGC -3'
(R):5'- CCACAATCGATTGGCAGCTTG -3'

Sequencing Primer
(F):5'- GCGGATCTCCAAAATATGCTTACTTC -3'
(R):5'- GTTTAAATCTCCAGGTCATCAGGC -3'
Posted On2016-12-15