Incidental Mutation 'R5808:2610028H24Rik'
ID448847
Institutional Source Beutler Lab
Gene Symbol 2610028H24Rik
Ensembl Gene ENSMUSG00000009114
Gene NameRIKEN cDNA 2610028H24 gene
SynonymsORF67
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5808 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location76449081-76461110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76450648 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 6 (R6W)
Ref Sequence ENSEMBL: ENSMUSP00000101055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092406] [ENSMUST00000105415]
Predicted Effect probably damaging
Transcript: ENSMUST00000092406
AA Change: R27W

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090061
Gene: ENSMUSG00000009114
AA Change: R27W

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
low complexity region 94 140 N/A INTRINSIC
Pfam:DUF4587 145 216 7.6e-33 PFAM
low complexity region 223 235 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105415
AA Change: R6W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101055
Gene: ENSMUSG00000009114
AA Change: R6W

DomainStartEndE-ValueType
low complexity region 73 119 N/A INTRINSIC
Pfam:DUF4587 124 195 4.4e-34 PFAM
low complexity region 202 214 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in 2610028H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02400:2610028H24Rik APN 10 76454810 missense possibly damaging 0.75
IGL02951:2610028H24Rik APN 10 76454702 splice site probably benign
PIT4283001:2610028H24Rik UTSW 10 76449259 start codon destroyed probably benign 0.01
R0013:2610028H24Rik UTSW 10 76457512 missense probably benign 0.32
R0295:2610028H24Rik UTSW 10 76454808 missense probably damaging 0.99
R2018:2610028H24Rik UTSW 10 76458065 missense possibly damaging 0.85
R2019:2610028H24Rik UTSW 10 76458065 missense possibly damaging 0.85
R2128:2610028H24Rik UTSW 10 76457515 missense possibly damaging 0.93
R2129:2610028H24Rik UTSW 10 76457515 missense possibly damaging 0.93
R4776:2610028H24Rik UTSW 10 76457512 missense probably benign 0.16
R5638:2610028H24Rik UTSW 10 76452895 missense probably benign 0.17
R5896:2610028H24Rik UTSW 10 76452830 missense probably benign 0.01
R5990:2610028H24Rik UTSW 10 76449289 missense probably benign 0.08
R6238:2610028H24Rik UTSW 10 76449262 missense possibly damaging 0.86
R6505:2610028H24Rik UTSW 10 76449281 missense probably benign 0.02
R7741:2610028H24Rik UTSW 10 76454717 missense probably damaging 0.99
X0026:2610028H24Rik UTSW 10 76458091 missense possibly damaging 0.91
Z1176:2610028H24Rik UTSW 10 76452863 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTCCCTCTGGGTTTAGG -3'
(R):5'- ACAAGATGCACTCCCTCTAGG -3'

Sequencing Primer
(F):5'- TAATCCTTAACAGAATGGGGGCCC -3'
(R):5'- TCCCTCTAGGAGCCTGCTG -3'
Posted On2016-12-15