Incidental Mutation 'R5808:Epha6'
ID 448867
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5808 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59682742 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 934 (I934K)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: I934K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: I934K

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsc1 A T 18: 20,086,829 C761* probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGTCAACTAGGGCTAG -3'
(R):5'- CTGCCATTTAACATTATCCAAGCTC -3'

Sequencing Primer
(F):5'- GTCAACTAGGGCTAGAATCTTCTGC -3'
(R):5'- AGCTCTCTATTCTAATTTAAAGCGTC -3'
Posted On 2016-12-15