Incidental Mutation 'R5808:Dsc1'
ID448870
Institutional Source Beutler Lab
Gene Symbol Dsc1
Ensembl Gene ENSMUSG00000044322
Gene Namedesmocollin 1
SynonymsDsc1a, Dsc1b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.105) question?
Stock #R5808 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20084184-20114871 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 20086829 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 761 (C761*)
Ref Sequence ENSEMBL: ENSMUSP00000153639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]
Predicted Effect probably null
Transcript: ENSMUST00000038710
AA Change: C761*
SMART Domains Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: C761*

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
Cadherin_pro 29 111 2.61e-41 SMART
CA 155 240 2.78e-9 SMART
CA 264 352 5.94e-27 SMART
CA 375 470 5.27e-10 SMART
CA 493 575 1.18e-21 SMART
Blast:CA 593 672 5e-46 BLAST
transmembrane domain 692 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224432
AA Change: C761*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224557
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik C T 10: 76,450,648 R6W probably damaging Het
9130019O22Rik A T 7: 127,384,913 probably benign Het
Ahnak T A 19: 9,010,235 V2961E possibly damaging Het
Aldh1a7 A T 19: 20,708,197 Y330N possibly damaging Het
Bag6 A G 17: 35,146,322 Y1041C probably damaging Het
Baz1b T A 5: 135,221,958 V866E probably benign Het
Bmpr2 A T 1: 59,867,401 Y551F probably benign Het
Cage1 A G 13: 38,022,325 probably benign Het
Caskin2 G T 11: 115,801,763 P732Q probably damaging Het
Cbfa2t2 T C 2: 154,517,826 probably null Het
Ccdc162 A T 10: 41,655,504 M502K possibly damaging Het
Cfap157 T C 2: 32,780,645 D197G probably damaging Het
CN725425 T A 15: 91,245,644 S237T probably benign Het
Defb40 T C 8: 18,975,079 H37R probably benign Het
Dis3l2 A C 1: 87,049,638 S836R possibly damaging Het
Dnah14 T C 1: 181,741,159 I2818T possibly damaging Het
Dpysl2 T A 14: 66,865,172 probably null Het
Dsg1b A T 18: 20,408,725 D763V probably damaging Het
Eif2ak1 C T 5: 143,883,994 P251L probably benign Het
Epha6 A T 16: 59,682,742 I934K probably damaging Het
Fbxo40 T C 16: 36,970,382 E122G probably damaging Het
Filip1 C T 9: 79,818,701 G879R possibly damaging Het
Frem2 A T 3: 53,652,563 F1508I probably damaging Het
Gja1 A G 10: 56,388,498 N318D probably benign Het
Gm11564 T C 11: 99,815,041 S188G unknown Het
Hlcs A G 16: 94,262,632 V523A probably benign Het
Kif1a C A 1: 93,042,698 E1041D probably damaging Het
Lamtor1 A G 7: 101,910,082 Y81C possibly damaging Het
Loxl1 A G 9: 58,294,449 L453S probably damaging Het
Mcf2l A G 8: 12,993,937 M1V probably null Het
Megf6 A G 4: 154,267,662 Q1208R probably benign Het
Morc2a T A 11: 3,683,781 I631N probably benign Het
Muc6 T C 7: 141,640,093 probably benign Het
Mybpc1 T C 10: 88,570,566 S139G possibly damaging Het
Myo18a T C 11: 77,829,301 F1017L probably benign Het
Nup62 A C 7: 44,829,992 Q477P possibly damaging Het
P2ry13 T A 3: 59,210,232 I42F probably benign Het
Ptprb G A 10: 116,339,487 R1129K probably benign Het
Rexo4 T A 2: 26,964,185 K45I probably damaging Het
Rnf213 G A 11: 119,436,295 V1703I probably benign Het
Sec23ip C A 7: 128,772,184 A710E probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slc41a2 T C 10: 83,313,498 T194A probably benign Het
Slc4a10 G A 2: 62,250,472 A348T probably damaging Het
Soat2 G A 15: 102,154,025 probably null Het
Srms T C 2: 181,208,755 S204G probably benign Het
Szt2 G A 4: 118,372,613 R2774C unknown Het
Tcf7l2 T C 19: 55,908,541 V182A probably damaging Het
Tmem167b C T 3: 108,560,243 R29H probably benign Het
Trappc12 T A 12: 28,746,864 D223V probably damaging Het
Ttc6 T A 12: 57,617,611 S383R possibly damaging Het
Ubr1 C T 2: 120,961,092 R137H possibly damaging Het
Vmn2r24 T A 6: 123,815,638 C641* probably null Het
Vrk3 A G 7: 44,759,874 D155G probably damaging Het
Xxylt1 T C 16: 31,050,685 Y199C probably damaging Het
Zbtb46 A T 2: 181,423,570 D262E probably benign Het
Zcchc9 A T 13: 91,800,647 S58T probably benign Het
Zfyve16 A T 13: 92,495,055 L1344* probably null Het
Other mutations in Dsc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Dsc1 APN 18 20101886 missense probably damaging 1.00
IGL00571:Dsc1 APN 18 20110138 missense probably damaging 1.00
IGL00790:Dsc1 APN 18 20094896 missense probably damaging 1.00
IGL00963:Dsc1 APN 18 20111986 missense probably null 0.01
IGL00972:Dsc1 APN 18 20088363 missense probably benign 0.32
IGL01112:Dsc1 APN 18 20094622 missense probably benign 0.02
IGL01458:Dsc1 APN 18 20099138 missense probably damaging 1.00
IGL01607:Dsc1 APN 18 20089663 missense probably damaging 1.00
IGL01794:Dsc1 APN 18 20110183 missense probably damaging 1.00
IGL01959:Dsc1 APN 18 20097225 missense probably damaging 1.00
IGL02066:Dsc1 APN 18 20108803 unclassified probably benign
IGL02365:Dsc1 APN 18 20108816 missense probably damaging 1.00
IGL02714:Dsc1 APN 18 20087485 missense probably damaging 1.00
IGL02959:Dsc1 APN 18 20108885 missense probably damaging 1.00
IGL03019:Dsc1 APN 18 20088364 missense probably benign 0.00
IGL03106:Dsc1 APN 18 20086644 splice site probably null
R0414:Dsc1 UTSW 18 20088354 missense possibly damaging 0.85
R0456:Dsc1 UTSW 18 20099112 missense probably damaging 1.00
R0612:Dsc1 UTSW 18 20114516 missense probably damaging 0.96
R0630:Dsc1 UTSW 18 20085862 missense probably damaging 1.00
R0646:Dsc1 UTSW 18 20096057 missense probably damaging 1.00
R0928:Dsc1 UTSW 18 20110249 splice site probably null
R0976:Dsc1 UTSW 18 20095041 splice site probably null
R1221:Dsc1 UTSW 18 20114542 nonsense probably null
R1398:Dsc1 UTSW 18 20088336 missense probably damaging 1.00
R1902:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R1903:Dsc1 UTSW 18 20095988 missense probably damaging 1.00
R2070:Dsc1 UTSW 18 20088296 splice site probably null
R2119:Dsc1 UTSW 18 20110152 missense probably benign 0.07
R3935:Dsc1 UTSW 18 20097241 missense probably benign 0.00
R4747:Dsc1 UTSW 18 20094558 missense probably damaging 1.00
R5034:Dsc1 UTSW 18 20095027 missense possibly damaging 0.91
R5243:Dsc1 UTSW 18 20099159 missense probably damaging 1.00
R5289:Dsc1 UTSW 18 20101853 missense possibly damaging 0.72
R5300:Dsc1 UTSW 18 20094860 missense probably damaging 1.00
R5354:Dsc1 UTSW 18 20087575 missense probably damaging 1.00
R5376:Dsc1 UTSW 18 20088446 missense probably benign 0.21
R5860:Dsc1 UTSW 18 20095024 missense probably damaging 1.00
R6059:Dsc1 UTSW 18 20110242 missense probably damaging 0.98
R6116:Dsc1 UTSW 18 20097299 missense probably benign 0.10
R6351:Dsc1 UTSW 18 20086769 missense probably damaging 1.00
R6422:Dsc1 UTSW 18 20095033 missense probably damaging 1.00
R6811:Dsc1 UTSW 18 20089654 missense probably benign
R6880:Dsc1 UTSW 18 20088372 missense probably damaging 0.99
R6941:Dsc1 UTSW 18 20097189 missense probably benign 0.00
R6997:Dsc1 UTSW 18 20086644 splice site probably null
R7255:Dsc1 UTSW 18 20097273 missense probably benign 0.12
R7456:Dsc1 UTSW 18 20086822 missense probably benign 0.00
R7492:Dsc1 UTSW 18 20107680 missense possibly damaging 0.46
R7503:Dsc1 UTSW 18 20085865 missense probably damaging 1.00
R8030:Dsc1 UTSW 18 20089571 missense probably benign
Z1176:Dsc1 UTSW 18 20114538 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CAGAGTGGGCACTTGAAGACTG -3'
(R):5'- ACAGAGTTTGGCCCACAATATC -3'

Sequencing Primer
(F):5'- TTACTTCACCAAGCCGAGGTTGAG -3'
(R):5'- GTTTGGCCCACAATATCTATGTTATG -3'
Posted On2016-12-15