Incidental Mutation 'R5809:Hibch'
ID448875
Institutional Source Beutler Lab
Gene Symbol Hibch
Ensembl Gene ENSMUSG00000041426
Gene Name3-hydroxyisobutyryl-Coenzyme A hydrolase
Synonyms2610509I15Rik, HIBYL-COA-H
MMRRC Submission 043394-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R5809 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location52844929-52920986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52853700 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 23 (L23Q)
Ref Sequence ENSEMBL: ENSMUSP00000124976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044478] [ENSMUST00000159352]
Predicted Effect probably benign
Transcript: ENSMUST00000044478
AA Change: L23Q

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045606
Gene: ENSMUSG00000041426
AA Change: L23Q

DomainStartEndE-ValueType
Pfam:ECH_1 43 282 6.6e-34 PFAM
Pfam:ECH_2 45 375 3.9e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159352
AA Change: L23Q

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124976
Gene: ENSMUSG00000041426
AA Change: L23Q

DomainStartEndE-ValueType
Pfam:ECH 44 299 1.3e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161552
Meta Mutation Damage Score 0.1054 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme responsible for hydrolysis of both HIBYL-CoA and beta-hydroxypropionyl-CoA. Mutations in this gene have been associated with 3-hyroxyisobutyryl-CoA hydrolase deficiency. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,708,885 R460G probably damaging Het
A230072I06Rik A G 8: 12,279,556 S4G unknown Het
AA623943 T C 11: 94,813,002 noncoding transcript Het
Abca13 T A 11: 9,293,692 S1852T probably damaging Het
Ackr2 G A 9: 121,909,474 C305Y probably damaging Het
Aebp1 T C 11: 5,870,257 V411A probably benign Het
Akp3 G A 1: 87,126,548 R269H probably benign Het
Alox15 C A 11: 70,350,882 G58W probably damaging Het
Ankle2 A G 5: 110,237,990 N369S probably damaging Het
Ankrd28 T A 14: 31,743,354 I289L probably benign Het
Atp13a4 T A 16: 29,433,987 T714S possibly damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Blm A T 7: 80,464,844 L1159Q probably damaging Het
Caskin1 G A 17: 24,504,547 V770I probably benign Het
Ccdc148 T A 2: 58,823,645 H498L probably damaging Het
Cdh26 T A 2: 178,460,126 Y179* probably null Het
Cela2a T A 4: 141,825,553 T38S probably benign Het
Cep350 A T 1: 155,933,341 N496K probably damaging Het
Cep89 A G 7: 35,417,726 Y251C probably damaging Het
Cluh T C 11: 74,661,700 S524P probably damaging Het
Cpeb4 T C 11: 31,872,801 S172P probably damaging Het
Ctnnd2 T C 15: 30,847,377 S705P probably damaging Het
D730048I06Rik C T 9: 35,789,001 C96Y probably damaging Het
Dock2 T G 11: 34,262,445 D1232A probably benign Het
Donson T C 16: 91,687,850 N9S possibly damaging Het
Gdf9 T C 11: 53,433,554 L50P probably benign Het
Gm10300 C T 4: 132,075,147 probably benign Het
Gm8369 A G 19: 11,504,884 probably benign Het
Gm8674 T A 13: 49,901,888 noncoding transcript Het
Hepacam T A 9: 37,384,805 S417R possibly damaging Het
Hmcn1 G A 1: 150,649,607 R3389C probably damaging Het
Hsp90ab1 G T 17: 45,570,649 probably benign Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Il12a A T 3: 68,695,262 probably benign Het
Ints13 A G 6: 146,576,349 V34A probably benign Het
Intu A C 3: 40,679,590 M418L probably damaging Het
Klra9 A G 6: 130,179,073 S240P probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndrg1 A G 15: 66,930,850 probably benign Het
Olfr181 T C 16: 58,926,497 T25A probably benign Het
Olfr739 T C 14: 50,425,448 *310Q probably null Het
Pax7 A G 4: 139,830,371 S30P probably damaging Het
Pdcd11 A T 19: 47,093,808 T54S probably benign Het
Pex19 T C 1: 172,130,739 V95A probably damaging Het
Pkhd1l1 A G 15: 44,519,707 I1121V probably benign Het
Pklr A T 3: 89,141,784 I146F probably benign Het
Plcb1 T C 2: 135,262,244 Y278H possibly damaging Het
Plcl1 T A 1: 55,696,001 I167N probably damaging Het
Plekhh1 A T 12: 79,078,687 I1241F probably benign Het
Plxnb2 G T 15: 89,167,571 D148E possibly damaging Het
Pthlh T C 6: 147,257,247 I72V probably damaging Het
Ptpru C T 4: 131,785,756 R880Q probably benign Het
Rrp36 T C 17: 46,668,006 K209E probably damaging Het
Scarb1 A G 5: 125,304,222 V86A probably damaging Het
Sh2d7 A C 9: 54,539,576 S37R probably benign Het
Slc13a2 A T 11: 78,397,821 V543E probably damaging Het
Smarcal1 A G 1: 72,591,137 T117A probably benign Het
Smok2a A G 17: 13,226,978 R481G possibly damaging Het
Smr2 G A 5: 88,108,840 A126T probably benign Het
Sspo G T 6: 48,460,045 W1304C possibly damaging Het
Svep1 A G 4: 58,116,524 S909P possibly damaging Het
Tchh A T 3: 93,445,573 K773N unknown Het
Tmem156 T C 5: 65,075,607 N140S possibly damaging Het
Tmem213 T C 6: 38,115,654 I107T possibly damaging Het
Tpd52l2 A G 2: 181,511,579 Y161C probably damaging Het
Trappc8 C T 18: 20,818,082 A1436T probably benign Het
Ubr3 A G 2: 69,965,511 Y933C possibly damaging Het
Ufm1 A T 3: 53,857,882 probably benign Het
Wdr27 A T 17: 14,883,669 L725Q probably damaging Het
Zdbf2 A G 1: 63,305,876 D1138G possibly damaging Het
Zkscan16 G A 4: 58,946,481 V119M probably damaging Het
Zmat5 A G 11: 4,722,431 D16G probably damaging Het
Other mutations in Hibch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Hibch APN 1 52885190 splice site probably benign
IGL00722:Hibch APN 1 52901320 missense probably damaging 0.96
IGL03130:Hibch APN 1 52885151 missense possibly damaging 0.88
IGL03327:Hibch APN 1 52920380 unclassified probably benign
IGL03346:Hibch APN 1 52920380 unclassified probably benign
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0033:Hibch UTSW 1 52905451 missense probably null 0.60
R0494:Hibch UTSW 1 52902896 missense possibly damaging 0.73
R1853:Hibch UTSW 1 52901335 critical splice donor site probably null
R4838:Hibch UTSW 1 52885178 missense possibly damaging 0.55
R5239:Hibch UTSW 1 52865608 missense probably damaging 1.00
R5531:Hibch UTSW 1 52845069 utr 5 prime probably benign
R5583:Hibch UTSW 1 52901247 missense probably damaging 1.00
R6246:Hibch UTSW 1 52904642 missense probably damaging 0.99
R6365:Hibch UTSW 1 52868937 splice site probably null
R7202:Hibch UTSW 1 52853715 splice site probably null
R8023:Hibch UTSW 1 52860038 missense probably benign 0.00
R8240:Hibch UTSW 1 52901335 critical splice donor site probably null
RF010:Hibch UTSW 1 52913732 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATGCATCATTTCATTGCTGTGC -3'
(R):5'- GAGACAGTACGATTTACCTGCATTC -3'

Sequencing Primer
(F):5'- CTGTGCCTGTCAACAGTGAATGAG -3'
(R):5'- CCTGCATTCATTATAGAAGCCTTAC -3'
Posted On2016-12-15