Incidental Mutation 'R5809:Zdbf2'
ID448877
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Namezinc finger, DBF-type containing 2
Synonyms4930431J08Rik, 9330107J05Rik
MMRRC Submission 043394-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R5809 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location63273265-63314576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63305876 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1138 (D1138G)
Ref Sequence ENSEMBL: ENSMUSP00000109767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: D1138G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: D1138G

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: D1138G

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: D1138G

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,708,885 R460G probably damaging Het
A230072I06Rik A G 8: 12,279,556 S4G unknown Het
AA623943 T C 11: 94,813,002 noncoding transcript Het
Abca13 T A 11: 9,293,692 S1852T probably damaging Het
Ackr2 G A 9: 121,909,474 C305Y probably damaging Het
Aebp1 T C 11: 5,870,257 V411A probably benign Het
Akp3 G A 1: 87,126,548 R269H probably benign Het
Alox15 C A 11: 70,350,882 G58W probably damaging Het
Ankle2 A G 5: 110,237,990 N369S probably damaging Het
Ankrd28 T A 14: 31,743,354 I289L probably benign Het
Atp13a4 T A 16: 29,433,987 T714S possibly damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Blm A T 7: 80,464,844 L1159Q probably damaging Het
Caskin1 G A 17: 24,504,547 V770I probably benign Het
Ccdc148 T A 2: 58,823,645 H498L probably damaging Het
Cdh26 T A 2: 178,460,126 Y179* probably null Het
Cela2a T A 4: 141,825,553 T38S probably benign Het
Cep350 A T 1: 155,933,341 N496K probably damaging Het
Cep89 A G 7: 35,417,726 Y251C probably damaging Het
Cluh T C 11: 74,661,700 S524P probably damaging Het
Cpeb4 T C 11: 31,872,801 S172P probably damaging Het
Ctnnd2 T C 15: 30,847,377 S705P probably damaging Het
D730048I06Rik C T 9: 35,789,001 C96Y probably damaging Het
Dock2 T G 11: 34,262,445 D1232A probably benign Het
Donson T C 16: 91,687,850 N9S possibly damaging Het
Gdf9 T C 11: 53,433,554 L50P probably benign Het
Gm10300 C T 4: 132,075,147 probably benign Het
Gm8369 A G 19: 11,504,884 probably benign Het
Gm8674 T A 13: 49,901,888 noncoding transcript Het
Hepacam T A 9: 37,384,805 S417R possibly damaging Het
Hibch T A 1: 52,853,700 L23Q probably benign Het
Hmcn1 G A 1: 150,649,607 R3389C probably damaging Het
Hsp90ab1 G T 17: 45,570,649 probably benign Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Il12a A T 3: 68,695,262 probably benign Het
Ints13 A G 6: 146,576,349 V34A probably benign Het
Intu A C 3: 40,679,590 M418L probably damaging Het
Klra9 A G 6: 130,179,073 S240P probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndrg1 A G 15: 66,930,850 probably benign Het
Olfr181 T C 16: 58,926,497 T25A probably benign Het
Olfr739 T C 14: 50,425,448 *310Q probably null Het
Pax7 A G 4: 139,830,371 S30P probably damaging Het
Pdcd11 A T 19: 47,093,808 T54S probably benign Het
Pex19 T C 1: 172,130,739 V95A probably damaging Het
Pkhd1l1 A G 15: 44,519,707 I1121V probably benign Het
Pklr A T 3: 89,141,784 I146F probably benign Het
Plcb1 T C 2: 135,262,244 Y278H possibly damaging Het
Plcl1 T A 1: 55,696,001 I167N probably damaging Het
Plekhh1 A T 12: 79,078,687 I1241F probably benign Het
Plxnb2 G T 15: 89,167,571 D148E possibly damaging Het
Pthlh T C 6: 147,257,247 I72V probably damaging Het
Ptpru C T 4: 131,785,756 R880Q probably benign Het
Rrp36 T C 17: 46,668,006 K209E probably damaging Het
Scarb1 A G 5: 125,304,222 V86A probably damaging Het
Sh2d7 A C 9: 54,539,576 S37R probably benign Het
Slc13a2 A T 11: 78,397,821 V543E probably damaging Het
Smarcal1 A G 1: 72,591,137 T117A probably benign Het
Smok2a A G 17: 13,226,978 R481G possibly damaging Het
Smr2 G A 5: 88,108,840 A126T probably benign Het
Sspo G T 6: 48,460,045 W1304C possibly damaging Het
Svep1 A G 4: 58,116,524 S909P possibly damaging Het
Tchh A T 3: 93,445,573 K773N unknown Het
Tmem156 T C 5: 65,075,607 N140S possibly damaging Het
Tmem213 T C 6: 38,115,654 I107T possibly damaging Het
Tpd52l2 A G 2: 181,511,579 Y161C probably damaging Het
Trappc8 C T 18: 20,818,082 A1436T probably benign Het
Ubr3 A G 2: 69,965,511 Y933C possibly damaging Het
Ufm1 A T 3: 53,857,882 probably benign Het
Wdr27 A T 17: 14,883,669 L725Q probably damaging Het
Zkscan16 G A 4: 58,946,481 V119M probably damaging Het
Zmat5 A G 11: 4,722,431 D16G probably damaging Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
R7989:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense not run
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense not run
Predicted Primers PCR Primer
(F):5'- GCCTCAGTTAGCCTCAAACG -3'
(R):5'- CCAAAACAGTTACTTCAGGTTCAGG -3'

Sequencing Primer
(F):5'- GCCTCAAACGAAAACTGTGTTG -3'
(R):5'- ACTTCAGGTTCAGGTGGTTCAACTAC -3'
Posted On2016-12-15