Mutagenetix > Incidental Mutations

Incidental Mutation 'R5809:Il12a'

448891

Institutional Source

Beutler Lab

Gene Symbol

Il12a

Ensembl Gene

ENSMUSG00000027776

Gene Name

interleukin 12a

Synonyms

IL-12p35, p35

MMRRC Submission

043394-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5809 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68690644-68698547 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 68695262 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000103446 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029345] [ENSMUST00000107816]

Predicted Effect

probably benign
Transcript: ENSMUST00000029345

SMART Domains

Protein: ENSMUSP00000029345
Gene: ENSMUSG00000027776

Domain	Start	End	E-Value	Type
low complexity region	1	26	N/A	INTRINSIC
Pfam:IL12	27	236	2.5e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107816

SMART Domains

Protein: ENSMUSP00000103446
Gene: ENSMUSG00000027776

Domain	Start	End	E-Value	Type
Pfam:IL12	1	215	6.8e-128	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191910

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195517

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. This cytokine is required for the T-cell-independent induction of interferon (IFN)-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Null homozygotes have decreased NK cell responses, altered effector T cell differentiation, and increased susceptibility to parasitic infections. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	A	G	3: 88,708,885	R460G	probably damaging	Het
A230072I06Rik	A	G	8: 12,279,556	S4G	unknown	Het
AA623943	T	C	11: 94,813,002		noncoding transcript	Het
Abca13	T	A	11: 9,293,692	S1852T	probably damaging	Het
Ackr2	G	A	9: 121,909,474	C305Y	probably damaging	Het
Aebp1	T	C	11: 5,870,257	V411A	probably benign	Het
Akp3	G	A	1: 87,126,548	R269H	probably benign	Het
Alox15	C	A	11: 70,350,882	G58W	probably damaging	Het
Ankle2	A	G	5: 110,237,990	N369S	probably damaging	Het
Ankrd28	T	A	14: 31,743,354	I289L	probably benign	Het
Atp13a4	T	A	16: 29,433,987	T714S	possibly damaging	Het
Birc6	A	C	17: 74,670,374	N4388T	probably damaging	Het
Blm	A	T	7: 80,464,844	L1159Q	probably damaging	Het
Caskin1	G	A	17: 24,504,547	V770I	probably benign	Het
Ccdc148	T	A	2: 58,823,645	H498L	probably damaging	Het
Cdh26	T	A	2: 178,460,126	Y179*	probably null	Het
Cela2a	T	A	4: 141,825,553	T38S	probably benign	Het
Cep350	A	T	1: 155,933,341	N496K	probably damaging	Het
Cep89	A	G	7: 35,417,726	Y251C	probably damaging	Het
Cluh	T	C	11: 74,661,700	S524P	probably damaging	Het
Cpeb4	T	C	11: 31,872,801	S172P	probably damaging	Het
Ctnnd2	T	C	15: 30,847,377	S705P	probably damaging	Het
D730048I06Rik	C	T	9: 35,789,001	C96Y	probably damaging	Het
Dock2	T	G	11: 34,262,445	D1232A	probably benign	Het
Donson	T	C	16: 91,687,850	N9S	possibly damaging	Het
Gdf9	T	C	11: 53,433,554	L50P	probably benign	Het
Gm10300	C	T	4: 132,075,147		probably benign	Het
Gm8369	A	G	19: 11,504,884		probably benign	Het
Gm8674	T	A	13: 49,901,888		noncoding transcript	Het
Hepacam	T	A	9: 37,384,805	S417R	possibly damaging	Het
Hibch	T	A	1: 52,853,700	L23Q	probably benign	Het
Hmcn1	G	A	1: 150,649,607	R3389C	probably damaging	Het
Hsp90ab1	G	T	17: 45,570,649		probably benign	Het
Hunk	C	A	16: 90,475,903	T365K	probably damaging	Het
Ints13	A	G	6: 146,576,349	V34A	probably benign	Het
Intu	A	C	3: 40,679,590	M418L	probably damaging	Het
Klra9	A	G	6: 130,179,073	S240P	probably damaging	Het
Mtpn	C	T	6: 35,512,290	D100N	probably benign	Het
Ndrg1	A	G	15: 66,930,850		probably benign	Het
Olfr181	T	C	16: 58,926,497	T25A	probably benign	Het
Olfr739	T	C	14: 50,425,448	*310Q	probably null	Het
Pax7	A	G	4: 139,830,371	S30P	probably damaging	Het
Pdcd11	A	T	19: 47,093,808	T54S	probably benign	Het
Pex19	T	C	1: 172,130,739	V95A	probably damaging	Het
Pkhd1l1	A	G	15: 44,519,707	I1121V	probably benign	Het
Pklr	A	T	3: 89,141,784	I146F	probably benign	Het
Plcb1	T	C	2: 135,262,244	Y278H	possibly damaging	Het
Plcl1	T	A	1: 55,696,001	I167N	probably damaging	Het
Plekhh1	A	T	12: 79,078,687	I1241F	probably benign	Het
Plxnb2	G	T	15: 89,167,571	D148E	possibly damaging	Het
Pthlh	T	C	6: 147,257,247	I72V	probably damaging	Het
Ptpru	C	T	4: 131,785,756	R880Q	probably benign	Het
Rrp36	T	C	17: 46,668,006	K209E	probably damaging	Het
Scarb1	A	G	5: 125,304,222	V86A	probably damaging	Het
Sh2d7	A	C	9: 54,539,576	S37R	probably benign	Het
Slc13a2	A	T	11: 78,397,821	V543E	probably damaging	Het
Smarcal1	A	G	1: 72,591,137	T117A	probably benign	Het
Smok2a	A	G	17: 13,226,978	R481G	possibly damaging	Het
Smr2	G	A	5: 88,108,840	A126T	probably benign	Het
Sspo	G	T	6: 48,460,045	W1304C	possibly damaging	Het
Svep1	A	G	4: 58,116,524	S909P	possibly damaging	Het
Tchh	A	T	3: 93,445,573	K773N	unknown	Het
Tmem156	T	C	5: 65,075,607	N140S	possibly damaging	Het
Tmem213	T	C	6: 38,115,654	I107T	possibly damaging	Het
Tpd52l2	A	G	2: 181,511,579	Y161C	probably damaging	Het
Trappc8	C	T	18: 20,818,082	A1436T	probably benign	Het
Ubr3	A	G	2: 69,965,511	Y933C	possibly damaging	Het
Ufm1	A	T	3: 53,857,882		probably benign	Het
Wdr27	A	T	17: 14,883,669	L725Q	probably damaging	Het
Zdbf2	A	G	1: 63,305,876	D1138G	possibly damaging	Het
Zkscan16	G	A	4: 58,946,481	V119M	probably damaging	Het
Zmat5	A	G	11: 4,722,431	D16G	probably damaging	Het

Other mutations in Il12a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01734:Il12a	APN	3	68691555	missense	possibly damaging	0.96
IGL01820:Il12a	APN	3	68692162	splice site	probably benign
IGL01989:Il12a	APN	3	68691576	splice site	probably benign
bakers_dozen	UTSW	3	68697987	frame shift	probably null
R0388:Il12a	UTSW	3	68695187	splice site	probably null
R0646:Il12a	UTSW	3	68697890	splice site	probably benign
R1083:Il12a	UTSW	3	68695333	missense	probably damaging	1.00
R1588:Il12a	UTSW	3	68695563	missense	probably benign	0.04
R2240:Il12a	UTSW	3	68694184	nonsense	probably null
R2909:Il12a	UTSW	3	68697987	frame shift	probably null
R2925:Il12a	UTSW	3	68697987	frame shift	probably null
R3696:Il12a	UTSW	3	68697987	frame shift	probably null
R3697:Il12a	UTSW	3	68697987	frame shift	probably null
R3698:Il12a	UTSW	3	68697987	frame shift	probably null
R4332:Il12a	UTSW	3	68695261	intron	probably benign
R6279:Il12a	UTSW	3	68697979	missense	probably damaging	0.96
R6305:Il12a	UTSW	3	68694178	missense	possibly damaging	0.80
R6847:Il12a	UTSW	3	68695566	missense	probably damaging	1.00
R7751:Il12a	UTSW	3	68697902	missense	probably damaging	1.00
R8188:Il12a	UTSW	3	68691539	missense	unknown
R8339:Il12a	UTSW	3	68692105	nonsense	probably null
RF003:Il12a	UTSW	3	68695229	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCCAAAAGCAGTTATGATGGTG -3'
(R):5'- CTAGAGCGCAGGACACAATG -3'

Sequencing Primer
(F):5'- TCTCAGCACTTGATAGGCAG -3'
(R):5'- CACAATGGGCAAGGAATCATTG -3'

Posted On

2016-12-15