Incidental Mutation 'R5809:Dock2'
ID448924
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 043394-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5809 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34262445 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1232 (D1232A)
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193]
Predicted Effect probably benign
Transcript: ENSMUST00000093193
AA Change: D1232A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: D1232A

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,708,885 R460G probably damaging Het
A230072I06Rik A G 8: 12,279,556 S4G unknown Het
AA623943 T C 11: 94,813,002 noncoding transcript Het
Abca13 T A 11: 9,293,692 S1852T probably damaging Het
Ackr2 G A 9: 121,909,474 C305Y probably damaging Het
Aebp1 T C 11: 5,870,257 V411A probably benign Het
Akp3 G A 1: 87,126,548 R269H probably benign Het
Alox15 C A 11: 70,350,882 G58W probably damaging Het
Ankle2 A G 5: 110,237,990 N369S probably damaging Het
Ankrd28 T A 14: 31,743,354 I289L probably benign Het
Atp13a4 T A 16: 29,433,987 T714S possibly damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Blm A T 7: 80,464,844 L1159Q probably damaging Het
Caskin1 G A 17: 24,504,547 V770I probably benign Het
Ccdc148 T A 2: 58,823,645 H498L probably damaging Het
Cdh26 T A 2: 178,460,126 Y179* probably null Het
Cela2a T A 4: 141,825,553 T38S probably benign Het
Cep350 A T 1: 155,933,341 N496K probably damaging Het
Cep89 A G 7: 35,417,726 Y251C probably damaging Het
Cluh T C 11: 74,661,700 S524P probably damaging Het
Cpeb4 T C 11: 31,872,801 S172P probably damaging Het
Ctnnd2 T C 15: 30,847,377 S705P probably damaging Het
D730048I06Rik C T 9: 35,789,001 C96Y probably damaging Het
Donson T C 16: 91,687,850 N9S possibly damaging Het
Gdf9 T C 11: 53,433,554 L50P probably benign Het
Gm10300 C T 4: 132,075,147 probably benign Het
Gm8369 A G 19: 11,504,884 probably benign Het
Gm8674 T A 13: 49,901,888 noncoding transcript Het
Hepacam T A 9: 37,384,805 S417R possibly damaging Het
Hibch T A 1: 52,853,700 L23Q probably benign Het
Hmcn1 G A 1: 150,649,607 R3389C probably damaging Het
Hsp90ab1 G T 17: 45,570,649 probably benign Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Il12a A T 3: 68,695,262 probably benign Het
Ints13 A G 6: 146,576,349 V34A probably benign Het
Intu A C 3: 40,679,590 M418L probably damaging Het
Klra9 A G 6: 130,179,073 S240P probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndrg1 A G 15: 66,930,850 probably benign Het
Olfr181 T C 16: 58,926,497 T25A probably benign Het
Olfr739 T C 14: 50,425,448 *310Q probably null Het
Pax7 A G 4: 139,830,371 S30P probably damaging Het
Pdcd11 A T 19: 47,093,808 T54S probably benign Het
Pex19 T C 1: 172,130,739 V95A probably damaging Het
Pkhd1l1 A G 15: 44,519,707 I1121V probably benign Het
Pklr A T 3: 89,141,784 I146F probably benign Het
Plcb1 T C 2: 135,262,244 Y278H possibly damaging Het
Plcl1 T A 1: 55,696,001 I167N probably damaging Het
Plekhh1 A T 12: 79,078,687 I1241F probably benign Het
Plxnb2 G T 15: 89,167,571 D148E possibly damaging Het
Pthlh T C 6: 147,257,247 I72V probably damaging Het
Ptpru C T 4: 131,785,756 R880Q probably benign Het
Rrp36 T C 17: 46,668,006 K209E probably damaging Het
Scarb1 A G 5: 125,304,222 V86A probably damaging Het
Sh2d7 A C 9: 54,539,576 S37R probably benign Het
Slc13a2 A T 11: 78,397,821 V543E probably damaging Het
Smarcal1 A G 1: 72,591,137 T117A probably benign Het
Smok2a A G 17: 13,226,978 R481G possibly damaging Het
Smr2 G A 5: 88,108,840 A126T probably benign Het
Sspo G T 6: 48,460,045 W1304C possibly damaging Het
Svep1 A G 4: 58,116,524 S909P possibly damaging Het
Tchh A T 3: 93,445,573 K773N unknown Het
Tmem156 T C 5: 65,075,607 N140S possibly damaging Het
Tmem213 T C 6: 38,115,654 I107T possibly damaging Het
Tpd52l2 A G 2: 181,511,579 Y161C probably damaging Het
Trappc8 C T 18: 20,818,082 A1436T probably benign Het
Ubr3 A G 2: 69,965,511 Y933C possibly damaging Het
Ufm1 A T 3: 53,857,882 probably benign Het
Wdr27 A T 17: 14,883,669 L725Q probably damaging Het
Zdbf2 A G 1: 63,305,876 D1138G possibly damaging Het
Zkscan16 G A 4: 58,946,481 V119M probably damaging Het
Zmat5 A G 11: 4,722,431 D16G probably damaging Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
toothskin UTSW 11 34464922 missense probably damaging 1.00
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6156:Dock2 UTSW 11 34247789 missense possibly damaging 0.51
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
R7397:Dock2 UTSW 11 34718989 missense probably benign 0.00
R7464:Dock2 UTSW 11 34695278 missense probably damaging 0.99
R7512:Dock2 UTSW 11 34312542 missense possibly damaging 0.95
R7556:Dock2 UTSW 11 34720951 missense probably benign 0.43
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGAAGTGTGCTGCCAG -3'
(R):5'- CACTTATGTAGAAGGCTGGATGGC -3'

Sequencing Primer
(F):5'- GGAAAATTCCTTGACTTTCTTTCCC -3'
(R):5'- GGCTGGACCAAAGAACCC -3'
Posted On2016-12-15