Incidental Mutation 'R5809:Olfr181'
ID448938
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission 043394-MU
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5809 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58926497 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 25 (T25A)
Ref Sequence ENSEMBL: ENSMUSP00000145877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect probably benign
Transcript: ENSMUST00000075361
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: T25A

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205742
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205986
AA Change: T25A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214942
Meta Mutation Damage Score 0.0935 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,708,885 R460G probably damaging Het
A230072I06Rik A G 8: 12,279,556 S4G unknown Het
AA623943 T C 11: 94,813,002 noncoding transcript Het
Abca13 T A 11: 9,293,692 S1852T probably damaging Het
Ackr2 G A 9: 121,909,474 C305Y probably damaging Het
Aebp1 T C 11: 5,870,257 V411A probably benign Het
Akp3 G A 1: 87,126,548 R269H probably benign Het
Alox15 C A 11: 70,350,882 G58W probably damaging Het
Ankle2 A G 5: 110,237,990 N369S probably damaging Het
Ankrd28 T A 14: 31,743,354 I289L probably benign Het
Atp13a4 T A 16: 29,433,987 T714S possibly damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Blm A T 7: 80,464,844 L1159Q probably damaging Het
Caskin1 G A 17: 24,504,547 V770I probably benign Het
Ccdc148 T A 2: 58,823,645 H498L probably damaging Het
Cdh26 T A 2: 178,460,126 Y179* probably null Het
Cela2a T A 4: 141,825,553 T38S probably benign Het
Cep350 A T 1: 155,933,341 N496K probably damaging Het
Cep89 A G 7: 35,417,726 Y251C probably damaging Het
Cluh T C 11: 74,661,700 S524P probably damaging Het
Cpeb4 T C 11: 31,872,801 S172P probably damaging Het
Ctnnd2 T C 15: 30,847,377 S705P probably damaging Het
D730048I06Rik C T 9: 35,789,001 C96Y probably damaging Het
Dock2 T G 11: 34,262,445 D1232A probably benign Het
Donson T C 16: 91,687,850 N9S possibly damaging Het
Gdf9 T C 11: 53,433,554 L50P probably benign Het
Gm10300 C T 4: 132,075,147 probably benign Het
Gm8369 A G 19: 11,504,884 probably benign Het
Gm8674 T A 13: 49,901,888 noncoding transcript Het
Hepacam T A 9: 37,384,805 S417R possibly damaging Het
Hibch T A 1: 52,853,700 L23Q probably benign Het
Hmcn1 G A 1: 150,649,607 R3389C probably damaging Het
Hsp90ab1 G T 17: 45,570,649 probably benign Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Il12a A T 3: 68,695,262 probably benign Het
Ints13 A G 6: 146,576,349 V34A probably benign Het
Intu A C 3: 40,679,590 M418L probably damaging Het
Klra9 A G 6: 130,179,073 S240P probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndrg1 A G 15: 66,930,850 probably benign Het
Olfr739 T C 14: 50,425,448 *310Q probably null Het
Pax7 A G 4: 139,830,371 S30P probably damaging Het
Pdcd11 A T 19: 47,093,808 T54S probably benign Het
Pex19 T C 1: 172,130,739 V95A probably damaging Het
Pkhd1l1 A G 15: 44,519,707 I1121V probably benign Het
Pklr A T 3: 89,141,784 I146F probably benign Het
Plcb1 T C 2: 135,262,244 Y278H possibly damaging Het
Plcl1 T A 1: 55,696,001 I167N probably damaging Het
Plekhh1 A T 12: 79,078,687 I1241F probably benign Het
Plxnb2 G T 15: 89,167,571 D148E possibly damaging Het
Pthlh T C 6: 147,257,247 I72V probably damaging Het
Ptpru C T 4: 131,785,756 R880Q probably benign Het
Rrp36 T C 17: 46,668,006 K209E probably damaging Het
Scarb1 A G 5: 125,304,222 V86A probably damaging Het
Sh2d7 A C 9: 54,539,576 S37R probably benign Het
Slc13a2 A T 11: 78,397,821 V543E probably damaging Het
Smarcal1 A G 1: 72,591,137 T117A probably benign Het
Smok2a A G 17: 13,226,978 R481G possibly damaging Het
Smr2 G A 5: 88,108,840 A126T probably benign Het
Sspo G T 6: 48,460,045 W1304C possibly damaging Het
Svep1 A G 4: 58,116,524 S909P possibly damaging Het
Tchh A T 3: 93,445,573 K773N unknown Het
Tmem156 T C 5: 65,075,607 N140S possibly damaging Het
Tmem213 T C 6: 38,115,654 I107T possibly damaging Het
Tpd52l2 A G 2: 181,511,579 Y161C probably damaging Het
Trappc8 C T 18: 20,818,082 A1436T probably benign Het
Ubr3 A G 2: 69,965,511 Y933C possibly damaging Het
Ufm1 A T 3: 53,857,882 probably benign Het
Wdr27 A T 17: 14,883,669 L725Q probably damaging Het
Zdbf2 A G 1: 63,305,876 D1138G possibly damaging Het
Zkscan16 G A 4: 58,946,481 V119M probably damaging Het
Zmat5 A G 11: 4,722,431 D16G probably damaging Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2404:Olfr181 UTSW 16 58925635 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
R8153:Olfr181 UTSW 16 58925786 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- ATCTTGGGAGTGATGGCAC -3'
(R):5'- TGACCCATGACCTATCCTGG -3'

Sequencing Primer
(F):5'- CAGGAGCAGCAGGAGTCCATC -3'
(R):5'- ATGACCTATCCTGGGCTTGCTG -3'
Posted On2016-12-15