Incidental Mutation 'R5809:Wdr27'
ID448941
Institutional Source Beutler Lab
Gene Symbol Wdr27
Ensembl Gene ENSMUSG00000046991
Gene NameWD repeat domain 27
Synonyms0610012K18Rik
MMRRC Submission 043394-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5809 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14818519-14943158 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14883669 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 725 (L725Q)
Ref Sequence ENSEMBL: ENSMUSP00000155992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170386] [ENSMUST00000228330] [ENSMUST00000232147]
Predicted Effect probably damaging
Transcript: ENSMUST00000170386
AA Change: L725Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126736
Gene: ENSMUSG00000046991
AA Change: L725Q

DomainStartEndE-ValueType
WD40 59 99 4.79e-1 SMART
WD40 114 149 6.36e1 SMART
WD40 152 192 3.93e-7 SMART
WD40 195 235 2.38e1 SMART
low complexity region 473 492 N/A INTRINSIC
WD40 498 539 1.48e1 SMART
WD40 542 581 5.26e-8 SMART
WD40 642 684 2.97e0 SMART
WD40 687 737 7.64e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228233
Predicted Effect probably damaging
Transcript: ENSMUST00000228330
AA Change: L725Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000232147
AA Change: L725Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.2769 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with multiple WD repeats. Proteins with these repeats may form scaffolds for protein-protein interaction and play key roles in cell signalling. Alternative splicing results in multiple transcript variants, but the full-length structure of some of these variants cannot be determined. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik A G 3: 88,708,885 R460G probably damaging Het
A230072I06Rik A G 8: 12,279,556 S4G unknown Het
AA623943 T C 11: 94,813,002 noncoding transcript Het
Abca13 T A 11: 9,293,692 S1852T probably damaging Het
Ackr2 G A 9: 121,909,474 C305Y probably damaging Het
Aebp1 T C 11: 5,870,257 V411A probably benign Het
Akp3 G A 1: 87,126,548 R269H probably benign Het
Alox15 C A 11: 70,350,882 G58W probably damaging Het
Ankle2 A G 5: 110,237,990 N369S probably damaging Het
Ankrd28 T A 14: 31,743,354 I289L probably benign Het
Atp13a4 T A 16: 29,433,987 T714S possibly damaging Het
Birc6 A C 17: 74,670,374 N4388T probably damaging Het
Blm A T 7: 80,464,844 L1159Q probably damaging Het
Caskin1 G A 17: 24,504,547 V770I probably benign Het
Ccdc148 T A 2: 58,823,645 H498L probably damaging Het
Cdh26 T A 2: 178,460,126 Y179* probably null Het
Cela2a T A 4: 141,825,553 T38S probably benign Het
Cep350 A T 1: 155,933,341 N496K probably damaging Het
Cep89 A G 7: 35,417,726 Y251C probably damaging Het
Cluh T C 11: 74,661,700 S524P probably damaging Het
Cpeb4 T C 11: 31,872,801 S172P probably damaging Het
Ctnnd2 T C 15: 30,847,377 S705P probably damaging Het
D730048I06Rik C T 9: 35,789,001 C96Y probably damaging Het
Dock2 T G 11: 34,262,445 D1232A probably benign Het
Donson T C 16: 91,687,850 N9S possibly damaging Het
Gdf9 T C 11: 53,433,554 L50P probably benign Het
Gm10300 C T 4: 132,075,147 probably benign Het
Gm8369 A G 19: 11,504,884 probably benign Het
Gm8674 T A 13: 49,901,888 noncoding transcript Het
Hepacam T A 9: 37,384,805 S417R possibly damaging Het
Hibch T A 1: 52,853,700 L23Q probably benign Het
Hmcn1 G A 1: 150,649,607 R3389C probably damaging Het
Hsp90ab1 G T 17: 45,570,649 probably benign Het
Hunk C A 16: 90,475,903 T365K probably damaging Het
Il12a A T 3: 68,695,262 probably benign Het
Ints13 A G 6: 146,576,349 V34A probably benign Het
Intu A C 3: 40,679,590 M418L probably damaging Het
Klra9 A G 6: 130,179,073 S240P probably damaging Het
Mtpn C T 6: 35,512,290 D100N probably benign Het
Ndrg1 A G 15: 66,930,850 probably benign Het
Olfr181 T C 16: 58,926,497 T25A probably benign Het
Olfr739 T C 14: 50,425,448 *310Q probably null Het
Pax7 A G 4: 139,830,371 S30P probably damaging Het
Pdcd11 A T 19: 47,093,808 T54S probably benign Het
Pex19 T C 1: 172,130,739 V95A probably damaging Het
Pkhd1l1 A G 15: 44,519,707 I1121V probably benign Het
Pklr A T 3: 89,141,784 I146F probably benign Het
Plcb1 T C 2: 135,262,244 Y278H possibly damaging Het
Plcl1 T A 1: 55,696,001 I167N probably damaging Het
Plekhh1 A T 12: 79,078,687 I1241F probably benign Het
Plxnb2 G T 15: 89,167,571 D148E possibly damaging Het
Pthlh T C 6: 147,257,247 I72V probably damaging Het
Ptpru C T 4: 131,785,756 R880Q probably benign Het
Rrp36 T C 17: 46,668,006 K209E probably damaging Het
Scarb1 A G 5: 125,304,222 V86A probably damaging Het
Sh2d7 A C 9: 54,539,576 S37R probably benign Het
Slc13a2 A T 11: 78,397,821 V543E probably damaging Het
Smarcal1 A G 1: 72,591,137 T117A probably benign Het
Smok2a A G 17: 13,226,978 R481G possibly damaging Het
Smr2 G A 5: 88,108,840 A126T probably benign Het
Sspo G T 6: 48,460,045 W1304C possibly damaging Het
Svep1 A G 4: 58,116,524 S909P possibly damaging Het
Tchh A T 3: 93,445,573 K773N unknown Het
Tmem156 T C 5: 65,075,607 N140S possibly damaging Het
Tmem213 T C 6: 38,115,654 I107T possibly damaging Het
Tpd52l2 A G 2: 181,511,579 Y161C probably damaging Het
Trappc8 C T 18: 20,818,082 A1436T probably benign Het
Ubr3 A G 2: 69,965,511 Y933C possibly damaging Het
Ufm1 A T 3: 53,857,882 probably benign Het
Zdbf2 A G 1: 63,305,876 D1138G possibly damaging Het
Zkscan16 G A 4: 58,946,481 V119M probably damaging Het
Zmat5 A G 11: 4,722,431 D16G probably damaging Het
Other mutations in Wdr27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Wdr27 APN 17 14928310 nonsense probably null
IGL00973:Wdr27 APN 17 14913878 missense probably benign 0.01
IGL01012:Wdr27 APN 17 14926247 missense probably damaging 1.00
IGL01924:Wdr27 APN 17 14917226 missense probably damaging 0.99
IGL02044:Wdr27 APN 17 14901769 missense possibly damaging 0.72
IGL02198:Wdr27 APN 17 14908598 missense possibly damaging 0.52
IGL02430:Wdr27 APN 17 14901800 missense probably damaging 0.98
IGL02496:Wdr27 APN 17 14892431 splice site probably benign
IGL02552:Wdr27 APN 17 14926191 missense probably damaging 1.00
IGL02590:Wdr27 APN 17 14917779 missense possibly damaging 0.93
IGL02892:Wdr27 APN 17 14876176 missense possibly damaging 0.95
IGL02957:Wdr27 APN 17 14910110 splice site probably benign
IGL03295:Wdr27 APN 17 14934575 missense possibly damaging 0.71
PIT4498001:Wdr27 UTSW 17 14934569 missense probably benign 0.01
R0329:Wdr27 UTSW 17 14934459 splice site probably benign
R0671:Wdr27 UTSW 17 14928396 missense probably benign 0.04
R1166:Wdr27 UTSW 17 14892471 missense probably damaging 1.00
R1308:Wdr27 UTSW 17 14928384 missense probably damaging 0.98
R1652:Wdr27 UTSW 17 14917270 missense probably benign 0.01
R1771:Wdr27 UTSW 17 14892441 missense probably damaging 1.00
R1966:Wdr27 UTSW 17 14934599 missense possibly damaging 0.86
R2106:Wdr27 UTSW 17 14920854 missense probably benign 0.44
R2131:Wdr27 UTSW 17 14928332 missense probably damaging 1.00
R3803:Wdr27 UTSW 17 14918109 missense probably benign 0.01
R4335:Wdr27 UTSW 17 14920756 splice site probably null
R4577:Wdr27 UTSW 17 14903462 missense probably benign 0.00
R4787:Wdr27 UTSW 17 14932554 missense possibly damaging 0.86
R4853:Wdr27 UTSW 17 14917213 splice site probably null
R4922:Wdr27 UTSW 17 14920754 splice site probably null
R4951:Wdr27 UTSW 17 14876133 missense probably damaging 0.99
R5784:Wdr27 UTSW 17 14926233 missense probably damaging 1.00
R6128:Wdr27 UTSW 17 14932534 nonsense probably null
R6584:Wdr27 UTSW 17 14901769 missense probably damaging 1.00
R6705:Wdr27 UTSW 17 14934590 missense probably damaging 1.00
R7511:Wdr27 UTSW 17 14883703 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTTCTCCAGAGCTTAG -3'
(R):5'- GTTAGGTGTCAGTAGTCTTTACAAG -3'

Sequencing Primer
(F):5'- GCTTAGAGACTAGTCACAGCCTTG -3'
(R):5'- ATGTGAGTCTGATCCCAAGGC -3'
Posted On2016-12-15