Mutagenetix > Incidental Mutation

Incidental Mutation 'R5022:Slc8a3'

448966

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

042613-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5022 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81199558 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 900 (V900A)

Ref Sequence

ENSEMBL: ENSMUSP00000082334 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208] [ENSMUST00000182366]

AlphaFold

S4R2P9

PDB Structure

The solution structure of Ca2+ binding domain 2B of the third isoform of the Na+/Ca2+ exchanger [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064594
AA Change: V906A

PolyPhen 2 Score 0.475 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: V906A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: V900A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: V900A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182208
AA Change: V907A

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: V907A

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182366

SMART Domains

Protein: ENSMUSP00000138803
Gene: ENSMUSG00000079055

Domain	Start	End	E-Value	Type
PDB:2LT9\|A	1	52	2e-28	PDB
low complexity region	82	93	N/A	INTRINSIC

Meta Mutation Damage Score

0.3998

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.6%

Validation Efficiency

99% (110/111)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca1	TCGACTGC	T	4: 53,041,570		probably null	Het
Abca15	T	C	7: 120,346,096	I465T	probably damaging	Het
Abca3	C	T	17: 24,374,300	R224C	probably damaging	Het
Abcb4	T	A	5: 8,909,054		probably null	Het
Acan	T	C	7: 79,092,808		probably null	Het
Aebp2	G	A	6: 140,637,730	R109Q	possibly damaging	Het
Agfg2	A	T	5: 137,660,160		probably null	Het
Ankib1	T	A	5: 3,734,011	I322F	possibly damaging	Het
AW551984	A	T	9: 39,597,965	N293K	probably benign	Het
BC028528	T	A	3: 95,888,823		probably benign	Het
Bicc1	A	G	10: 70,947,883	S393P	possibly damaging	Het
Birc6	A	G	17: 74,692,332	Y4656C	probably damaging	Het
Bmp3	A	G	5: 98,872,824	R369G	probably damaging	Het
C1d	T	A	11: 17,266,674	N135K	probably benign	Het
Ccdc148	G	A	2: 58,827,632	A453V	probably damaging	Het
Cd163	C	T	6: 124,325,288	T937I	probably damaging	Het
Celf2	C	T	2: 6,607,847		probably benign	Het
Chga	T	C	12: 102,562,837	W358R	probably damaging	Het
Clec4b2	A	T	6: 123,200,956	S77C	probably null	Het
Crim1	T	C	17: 78,280,129	V221A	possibly damaging	Het
D630003M21Rik	A	T	2: 158,217,633	S116T	probably damaging	Het
Dlg5	T	C	14: 24,136,622	E1847G	probably damaging	Het
Dmxl1	T	A	18: 49,895,127	I2206K	probably damaging	Het
Dusp7	T	A	9: 106,373,741	L355Q	probably damaging	Het
Exd2	T	A	12: 80,496,790	N582K	probably damaging	Het
Fbln1	G	A	15: 85,237,626	S316N	probably damaging	Het
Fchsd1	A	G	18: 37,964,810	I340T	possibly damaging	Het
Fn1	T	C	1: 71,624,179	Y1050C	probably damaging	Het
Fsip2	A	G	2: 82,979,429	I2031V	probably benign	Het
Gm10803	A	C	2: 93,564,172	L96F	probably damaging	Het
Gm12169	T	A	11: 46,528,532	D58E	probably damaging	Het
Gm14569	T	C	X: 36,430,817	D1413G	probably benign	Het
Gm15455	T	C	1: 33,837,351		noncoding transcript	Het
Gm1818	G	C	12: 48,555,535		noncoding transcript	Het
Gm4907	G	A	X: 23,907,241	G327E	probably damaging	Het
Gm5039	T	C	12: 88,321,301	I61V	probably benign	Het
Gm5420	A	T	10: 21,691,727		noncoding transcript	Het
Gm6803	A	T	12: 88,018,711	S21T	unknown	Het
Gm7104	A	T	12: 88,285,759		noncoding transcript	Het
Gp2	A	G	7: 119,449,114	I427T	probably damaging	Het
Gpc4	G	A	X: 52,074,563	R148C	probably damaging	Het
Gpr142	A	C	11: 114,804,388	S60R	probably benign	Het
Helz2	T	C	2: 181,240,569	R144G	probably benign	Het
Herc1	A	T	9: 66,470,326	K3458M	possibly damaging	Het
Hnf4g	G	T	3: 3,644,587	A144S	probably damaging	Het
Irs2	A	C	8: 10,987,012	*1322G	probably null	Het
Keg1	A	G	19: 12,719,157	N288S	probably damaging	Het
Kif19a	G	A	11: 114,767,227	M37I	probably benign	Het
Klhl1	G	A	14: 96,136,706	P635S	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lsm11	T	C	11: 45,944,839	D25G	probably damaging	Het
Manea	A	T	4: 26,336,630	Y215*	probably null	Het
Mdga2	C	T	12: 66,470,760	C100Y	possibly damaging	Het
Mthfd1	T	G	12: 76,294,374	V480G	probably damaging	Het
Mthfd1	T	A	12: 76,301,328	M582K	probably damaging	Het
Myh7b	G	C	2: 155,632,373	R1669S	possibly damaging	Het
Nanos1	T	C	19: 60,756,980	Y239H	probably damaging	Het
Nat8	G	A	6: 85,830,857	T98I	possibly damaging	Het
Ndufs3	C	A	2: 90,898,660	A161S	probably benign	Het
Nexmif	A	T	X: 104,087,350	N320K	probably damaging	Het
Olfr1216	A	G	2: 89,014,043	V7A	probably damaging	Het
Olfr1228	C	T	2: 89,249,417	M92I	probably benign	Het
Olfr164	A	T	16: 19,286,059	V228D	probably damaging	Het
Olfr239	T	C	17: 33,199,777	F239S	probably damaging	Het
Olfr457	A	T	6: 42,471,287	V297E	possibly damaging	Het
Olfr589	G	A	7: 103,155,735	P4L	probably benign	Het
Olfr727	T	C	14: 50,127,012	V145A	possibly damaging	Het
Olfr822	T	C	10: 130,074,593	L61P	probably damaging	Het
Pcdhb14	T	A	18: 37,450,170	N776K	probably benign	Het
Pip5k1c	G	A	10: 81,310,889		probably null	Het
Plk4	G	A	3: 40,802,077		probably null	Het
Prmt8	A	G	6: 127,711,163	Y231H	possibly damaging	Het
Prpf4b	T	C	13: 34,883,599		probably benign	Het
Ptpn21	G	A	12: 98,679,407	R1091C	probably damaging	Het
Pwwp2b	C	T	7: 139,255,578	P312S	possibly damaging	Het
Rad21	A	T	15: 51,966,706	I503K	probably benign	Het
Rai14	A	G	15: 10,574,506	S789P	probably damaging	Het
Rbm26	C	T	14: 105,144,252	D486N	probably damaging	Het
Rnf20	A	G	4: 49,642,016		probably benign	Het
Ros1	A	G	10: 52,124,075	V1118A	possibly damaging	Het
Sema3d	A	C	5: 12,584,956	Y663S	probably damaging	Het
Serpina6	A	G	12: 103,651,712	W281R	probably damaging	Het
Spats2l	G	T	1: 57,879,556	V30L	probably damaging	Het
Spg21	A	G	9: 65,475,949	D139G	probably damaging	Het
Sun3	T	C	11: 9,038,314	T3A	probably damaging	Het
Tcrg-V1	T	A	13: 19,340,231	S42T	probably benign	Het
Tep1	A	G	14: 50,828,999	Y2335H	probably benign	Het
Timm21	C	A	18: 84,949,414	V112L	possibly damaging	Het
Tlk1	A	T	2: 70,742,065	N386K	probably benign	Het
Trappc10	G	T	10: 78,217,160	F260L	possibly damaging	Het
Trmt112	T	C	19: 6,910,753	V91A	probably benign	Het
Ucp2	A	T	7: 100,498,372	N186I	possibly damaging	Het
Vmn1r119	A	G	7: 21,012,320	S46P	probably benign	Het
Vmn2r101	A	T	17: 19,611,387		probably null	Het
Vmn2r105	T	A	17: 20,208,414	H800L	probably damaging	Het
Vmn2r69	T	C	7: 85,411,159	M406V	possibly damaging	Het
Vmn2r84	A	G	10: 130,386,548	L601P	probably damaging	Het
Vps16	A	G	2: 130,439,452	S235G	probably benign	Het
Wap	T	C	11: 6,637,339		probably benign	Het
Wdr11	A	G	7: 129,624,711	I744M	probably benign	Het
Xiap	T	C	X: 42,094,465	F23L	probably benign	Het
Xkr7	A	G	2: 153,054,380	T385A	probably benign	Het
Zfp524	A	T	7: 5,018,417	I315F	probably benign	Het
Zfp62	T	A	11: 49,215,729	S216T	probably damaging	Het
Znfx1	T	C	2: 167,039,826	Y217C	probably damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6062:Slc8a3	UTSW	12	81314350	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- ATGTGTCTGCTCCAGGGATGAG -3'
(R):5'- TGCCGTCAATGTCTTCCTGG -3'

Sequencing Primer
(F):5'- TCTGCTCCAGGGATGAGTAACC -3'
(R):5'- ATCTACTGGGCCATGCAGG -3'

Posted On

2016-12-16