Incidental Mutation 'R5017:Pde11a'
ID448970
Institutional Source Beutler Lab
Gene Symbol Pde11a
Ensembl Gene ENSMUSG00000075270
Gene Namephosphodiesterase 11A
SynonymsA630086N24Rik, 6330414F14Rik
MMRRC Submission 042608-MU
Accession Numbers

Genbank: NM_001081033; MGI: 3036251

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R5017 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location75989141-76338774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76136367 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 579 (D579E)
Ref Sequence ENSEMBL: ENSMUSP00000097572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099992]
Predicted Effect probably benign
Transcript: ENSMUST00000099992
AA Change: D579E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097572
Gene: ENSMUSG00000075270
AA Change: D579E

DomainStartEndE-ValueType
low complexity region 68 82 N/A INTRINSIC
low complexity region 149 164 N/A INTRINSIC
GAF 217 380 1.79e-30 SMART
GAF 402 568 2.34e-25 SMART
HDc 661 830 7.75e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144892
SMART Domains Protein: ENSMUSP00000115662
Gene: ENSMUSG00000075270

DomainStartEndE-ValueType
GAF 41 207 9.16e-19 SMART
HDc 269 438 2.04e-5 SMART
Meta Mutation Damage Score 0.1392 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a member of the PDE protein superfamily. Mutations in this gene are a cause of Cushing disease and adrenocortical hyperplasia. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have enlarged lateral ventricles and exhibit abnormal behavior. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Pde11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Pde11a APN 2 76215385 missense probably damaging 1.00
IGL01528:Pde11a APN 2 76194956 splice site probably benign
IGL02117:Pde11a APN 2 75991262 missense probably damaging 1.00
IGL02428:Pde11a APN 2 76046845 missense possibly damaging 0.68
IGL02455:Pde11a APN 2 76158393 missense possibly damaging 0.58
IGL02731:Pde11a APN 2 75991239 missense probably benign 0.00
IGL03068:Pde11a APN 2 76017864 missense probably damaging 1.00
IGL03081:Pde11a APN 2 76075930 splice site probably benign
D4186:Pde11a UTSW 2 76291290 missense probably damaging 1.00
R0323:Pde11a UTSW 2 76046774 splice site probably null
R0433:Pde11a UTSW 2 76337706 missense possibly damaging 0.47
R1226:Pde11a UTSW 2 76158354 missense probably benign 0.10
R1542:Pde11a UTSW 2 76046855 missense probably benign 0.25
R1941:Pde11a UTSW 2 76291250 missense probably benign 0.10
R2107:Pde11a UTSW 2 76337922 missense probably damaging 1.00
R2394:Pde11a UTSW 2 76059061 missense probably benign 0.00
R3689:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3690:Pde11a UTSW 2 76291166 missense probably damaging 1.00
R3945:Pde11a UTSW 2 76075931 splice site probably benign
R4073:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4074:Pde11a UTSW 2 76337898 missense probably damaging 1.00
R4588:Pde11a UTSW 2 76029303 missense probably damaging 1.00
R4602:Pde11a UTSW 2 76158333 missense probably benign 0.05
R4604:Pde11a UTSW 2 76337793 missense possibly damaging 0.89
R4609:Pde11a UTSW 2 76291241 missense possibly damaging 0.94
R4610:Pde11a UTSW 2 76158333 missense probably benign 0.05
R5519:Pde11a UTSW 2 76075955 missense probably damaging 1.00
R5930:Pde11a UTSW 2 76139831 splice site probably null
R6000:Pde11a UTSW 2 76017860 missense probably damaging 0.98
R6018:Pde11a UTSW 2 76017850 missense probably benign 0.00
R6913:Pde11a UTSW 2 76337740 missense probably damaging 1.00
R7117:Pde11a UTSW 2 76076004 missense probably damaging 1.00
R7258:Pde11a UTSW 2 76139906 missense possibly damaging 0.91
R7267:Pde11a UTSW 2 76337845 missense probably damaging 1.00
R7409:Pde11a UTSW 2 76005984 missense
R7451:Pde11a UTSW 2 76022773 missense possibly damaging 0.89
R7452:Pde11a UTSW 2 76136414 missense probably damaging 1.00
R7598:Pde11a UTSW 2 76136423 missense probably damaging 1.00
R7671:Pde11a UTSW 2 76215353 missense possibly damaging 0.81
R7886:Pde11a UTSW 2 76291203 missense probably benign
R7969:Pde11a UTSW 2 76291203 missense probably benign
R8045:Pde11a UTSW 2 76022728 missense probably damaging 0.99
Z1176:Pde11a UTSW 2 76194905 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGAGACCCAGTGACGAGAG -3'
(R):5'- GGAACTGTCTCTGGTGACTG -3'

Sequencing Primer
(F):5'- GACCAGTGCTCTAAAAGATTCTGAGC -3'
(R):5'- GTGACTGCCTGCTTTCATATTAG -3'
Posted On2016-12-20