Incidental Mutation 'R5017:Gm10722'
ID448972
Institutional Source Beutler Lab
Gene Symbol Gm10722
Ensembl Gene ENSMUSG00000091028
Gene Namepredicted gene 10722
Synonyms
MMRRC Submission 042608-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R5017 (G1)
Quality Score21
Status Validated
Chromosome9
Chromosomal Location3000922-3002330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3000937 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 6 (C6R)
Ref Sequence ENSEMBL: ENSMUSP00000132394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151376] [ENSMUST00000177722] [ENSMUST00000178077] [ENSMUST00000178348] [ENSMUST00000179881]
Predicted Effect probably benign
Transcript: ENSMUST00000151376
AA Change: C6R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132394
Gene: ENSMUSG00000091028
AA Change: C6R

DomainStartEndE-ValueType
internal_repeat_2 8 50 1.25e-5 PROSPERO
internal_repeat_1 11 88 6.98e-39 PROSPERO
internal_repeat_2 66 108 1.25e-5 PROSPERO
internal_repeat_1 89 166 6.98e-39 PROSPERO
transmembrane domain 187 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177722
SMART Domains Protein: ENSMUSP00000136598
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 1.14e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 1.14e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178077
SMART Domains Protein: ENSMUSP00000136761
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 19 4.71e-8 PROSPERO
transmembrane domain 26 48 N/A INTRINSIC
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 136 4.71e-8 PROSPERO
transmembrane domain 156 178 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178348
SMART Domains Protein: ENSMUSP00000137273
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 48 1.34e-9 PROSPERO
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 165 1.34e-9 PROSPERO
transmembrane domain 196 218 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179881
SMART Domains Protein: ENSMUSP00000136541
Gene: ENSMUSG00000096385

DomainStartEndE-ValueType
internal_repeat_1 1 46 5.29e-7 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 182 5.29e-7 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181242
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.1%
  • 3x: 97.0%
  • 10x: 94.3%
  • 20x: 87.9%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,676 F167I unknown Het
Adamdec1 T C 14: 68,573,245 D154G probably benign Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef3 G T 14: 27,265,530 R20L possibly damaging Het
Birc2 A T 9: 7,818,885 C568* probably null Het
Cep44 A G 8: 56,544,207 S99P possibly damaging Het
Clstn2 A G 9: 97,483,086 W456R probably damaging Het
Cog5 T A 12: 31,920,605 S783T probably benign Het
Endod1 G A 9: 14,356,891 R433* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gdpd4 C A 7: 98,004,275 Y498* probably null Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Ifit3 A C 19: 34,587,192 N46T possibly damaging Het
Kcnh8 T C 17: 52,893,930 L464S probably damaging Het
Lrrc9 C A 12: 72,506,325 R1334S possibly damaging Het
Macf1 A G 4: 123,452,113 F2631L probably damaging Het
Mafa T C 15: 75,747,489 H145R probably benign Het
Muc6 T C 7: 141,640,528 T1411A probably benign Het
Nos3 A G 5: 24,366,719 probably benign Het
Nwd2 T A 5: 63,650,141 probably benign Het
Olfr160 A T 9: 37,711,525 Y251* probably null Het
Olfr44 A T 9: 39,484,755 M166K possibly damaging Het
Olfr981 A T 9: 40,022,376 probably benign Het
Pde11a A T 2: 76,136,367 D579E probably benign Het
Phkb A T 8: 86,049,809 H954L probably benign Het
Phldb3 C T 7: 24,620,096 T353M probably damaging Het
Pigu A T 2: 155,299,208 probably null Het
Pla2r1 A G 2: 60,522,760 probably null Het
Polr1c G T 17: 46,247,709 probably benign Het
Setbp1 C A 18: 78,856,594 G1286V possibly damaging Het
Siglecg T A 7: 43,411,386 probably benign Het
Slc25a46 A T 18: 31,605,783 H118Q probably damaging Het
Sycp1 A T 3: 102,895,987 probably null Het
Tmem132c A G 5: 127,563,350 T862A probably benign Het
Tmem256 T C 11: 69,838,992 probably benign Het
Tpr A T 1: 150,398,637 E98D probably benign Het
Trdn A G 10: 33,468,159 D623G probably benign Het
Trip11 T C 12: 101,846,620 N1485S probably benign Het
Trpm1 T C 7: 64,244,832 probably benign Het
Uhrf1bp1 T A 17: 27,894,739 L1295* probably null Het
Vmn1r227 T C 17: 20,736,078 noncoding transcript Het
Xpo6 G A 7: 126,104,747 A21V probably benign Het
Zfp276 A G 8: 123,264,977 probably benign Het
Other mutations in Gm10722
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Gm10722 APN 9 3002230 missense probably damaging 0.98
PIT4131001:Gm10722 UTSW 9 3001414 unclassified probably benign
PIT4142001:Gm10722 UTSW 9 3001350 missense probably benign
R0148:Gm10722 UTSW 9 3001405 missense probably null
R0335:Gm10722 UTSW 9 3001048 missense probably null
R4162:Gm10722 UTSW 9 3001041 missense probably benign
R4327:Gm10722 UTSW 9 3000937 missense probably benign
R4449:Gm10722 UTSW 9 3001041 missense probably benign
R4516:Gm10722 UTSW 9 3000937 missense probably benign
R4807:Gm10722 UTSW 9 3000937 missense probably benign
R4998:Gm10722 UTSW 9 3001041 missense probably benign
R5021:Gm10722 UTSW 9 3001041 missense probably benign
R5075:Gm10722 UTSW 9 3001041 missense probably benign
R5135:Gm10722 UTSW 9 3000937 missense probably benign
R5152:Gm10722 UTSW 9 3001041 missense probably benign
R5226:Gm10722 UTSW 9 3000937 missense probably benign
R5482:Gm10722 UTSW 9 3001041 missense probably benign
R7381:Gm10722 UTSW 9 3001235 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTCGTCAACTGTATGTTTCTCATTTT -3'
(R):5'- GCACACTGTAGGACCTGGAATAT -3'

Sequencing Primer
(F):5'- GCCATATTCCACGTCCTATAGTG -3'
(R):5'- TCCACTGTAGGACATGGAATATGGC -3'
Posted On2016-12-20