Incidental Mutation 'R5815:D1Pas1'
ID448980
Institutional Source Beutler Lab
Gene Symbol D1Pas1
Ensembl Gene ENSMUSG00000039224
Gene NameDNA segment, Chr 1, Pasteur Institute 1
SynonymsPl10
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5815 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location186967416-186970627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 186968009 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 45 (N45I)
Ref Sequence ENSEMBL: ENSMUSP00000035261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045108]
Predicted Effect probably damaging
Transcript: ENSMUST00000045108
AA Change: N45I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035261
Gene: ENSMUSG00000039224
AA Change: N45I

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 80 102 N/A INTRINSIC
low complexity region 104 122 N/A INTRINSIC
DEXDc 198 417 9.08e-66 SMART
HELICc 454 535 1.23e-35 SMART
low complexity region 580 596 N/A INTRINSIC
low complexity region 598 654 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191895
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in D1Pas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:D1Pas1 APN 1 186969412 missense possibly damaging 0.55
IGL00921:D1Pas1 APN 1 186968786 missense probably benign 0.44
R1693:D1Pas1 UTSW 1 186968029 missense probably benign
R2029:D1Pas1 UTSW 1 186968089 missense possibly damaging 0.53
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3732:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3733:D1Pas1 UTSW 1 186968097 missense probably benign 0.00
R3930:D1Pas1 UTSW 1 186968280 missense probably damaging 1.00
R5302:D1Pas1 UTSW 1 186969445 missense probably damaging 1.00
R6705:D1Pas1 UTSW 1 186968379 missense probably benign 0.00
R7023:D1Pas1 UTSW 1 186968008 missense probably damaging 0.96
R7747:D1Pas1 UTSW 1 186968677 missense probably benign 0.08
R7862:D1Pas1 UTSW 1 186968152 missense probably damaging 1.00
R7945:D1Pas1 UTSW 1 186968152 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCTCAGCAGAGGCAAG -3'
(R):5'- AATTTGCCAAAGCCACTTCTAC -3'

Sequencing Primer
(F):5'- AGGCAAGCCCCAGAGTTCTC -3'
(R):5'- GCTGCCAACACTCTCGTAG -3'
Posted On2016-12-20