Incidental Mutation 'R5815:Apmap'
ID448983
Institutional Source Beutler Lab
Gene Symbol Apmap
Ensembl Gene ENSMUSG00000033096
Gene Nameadipocyte plasma membrane associated protein
Synonyms2310001A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5815 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150583080-150608567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150600251 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 68 (S68G)
Ref Sequence ENSEMBL: ENSMUSP00000040840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046399]
Predicted Effect probably benign
Transcript: ENSMUST00000046399
AA Change: S68G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040840
Gene: ENSMUSG00000033096
AA Change: S68G

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Pfam:SGL 101 327 1.4e-17 PFAM
Pfam:Str_synth 200 288 1.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145325
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Apmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03135:Apmap APN 2 150587115 missense possibly damaging 0.89
R0898:Apmap UTSW 2 150585749 splice site probably benign
R2267:Apmap UTSW 2 150588901 critical splice donor site probably null
R4171:Apmap UTSW 2 150584067 missense probably benign 0.01
R5456:Apmap UTSW 2 150590069 missense probably benign 0.00
R5838:Apmap UTSW 2 150585857 missense probably damaging 1.00
R5846:Apmap UTSW 2 150608421 missense probably damaging 0.99
R6117:Apmap UTSW 2 150600332 missense probably benign 0.13
R6899:Apmap UTSW 2 150594308 missense probably benign 0.07
R8527:Apmap UTSW 2 150586465 missense probably benign 0.21
R8542:Apmap UTSW 2 150586465 missense probably benign 0.21
R8734:Apmap UTSW 2 150588904 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCTGAATCTGATCTTCATACCTGG -3'
(R):5'- AACTAGGTGAGCGGTTGTGC -3'

Sequencing Primer
(F):5'- CCTGGTTTATATCACAATGTCAGAG -3'
(R):5'- TTGAGAGCGGCCTTCAAG -3'
Posted On2016-12-20