Incidental Mutation 'R5815:Reln'
ID 448989
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5815 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 21884454-22344702 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21947433 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 2345 (M2345T)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000062372
AA Change: M2345T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: M2345T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084713
Predicted Effect probably damaging
Transcript: ENSMUST00000161356
AA Change: M2345T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: M2345T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162103
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 (GRCm38) D226G probably benign Het
Ago2 T C 15: 73,107,366 (GRCm38) probably null Het
Aldh1a1 C A 19: 20,630,670 (GRCm38) D285E probably benign Het
Alms1 T C 6: 85,622,838 (GRCm38) S1549P probably damaging Het
Apmap T C 2: 150,600,251 (GRCm38) S68G probably benign Het
Atp8a1 A T 5: 67,749,071 (GRCm38) I500N probably benign Het
B3gnt7 A C 1: 86,305,788 (GRCm38) D135A probably benign Het
Bms1 A T 6: 118,404,279 (GRCm38) L692H probably damaging Het
Cdk17 T A 10: 93,228,697 (GRCm38) V276E probably damaging Het
Cep290 A T 10: 100,558,108 (GRCm38) E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 (GRCm38) G693V probably damaging Het
Crocc A T 4: 141,035,196 (GRCm38) V661E probably damaging Het
D1Pas1 A T 1: 186,968,009 (GRCm38) N45I probably damaging Het
Ddx19a C T 8: 110,979,149 (GRCm38) W223* probably null Het
Ddx60 C A 8: 61,963,722 (GRCm38) S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 (GRCm38) N363K probably damaging Het
Gm57859 C A 11: 113,687,957 (GRCm38) probably null Het
Gpr151 G A 18: 42,579,385 (GRCm38) T76M probably benign Het
Inhbc C T 10: 127,357,449 (GRCm38) V233I probably benign Het
Ippk C T 13: 49,446,363 (GRCm38) L233F probably damaging Het
Lama2 A G 10: 26,986,851 (GRCm38) V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 (GRCm38) Q271R probably benign Het
Mia2 A T 12: 59,174,106 (GRCm38) K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 (GRCm38) L277R probably damaging Het
Myo7b A T 18: 31,966,288 (GRCm38) F1694I probably damaging Het
Obscn T C 11: 59,082,189 (GRCm38) probably null Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,395,654 (GRCm38) probably null Het
Or2w6 T C 13: 21,658,537 (GRCm38) Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 (GRCm38) T984A probably benign Het
Pcdh20 T C 14: 88,470,876 (GRCm38) S39G probably benign Het
Pdia3 T A 2: 121,436,411 (GRCm38) Y467* probably null Het
Ptpn13 C A 5: 103,597,690 (GRCm38) probably null Het
Rnf126 A T 10: 79,766,769 (GRCm38) I20N probably benign Het
Satb1 A G 17: 51,782,953 (GRCm38) S289P possibly damaging Het
Scd4 A T 19: 44,337,564 (GRCm38) H119L probably damaging Het
Sco2 T C 15: 89,372,371 (GRCm38) T27A probably benign Het
Slc39a14 A T 14: 70,306,745 (GRCm38) I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 (GRCm38) V220E probably benign Het
Themis3 C T 17: 66,555,704 (GRCm38) V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 (GRCm38) T448S probably benign Het
Tspan33 G A 6: 29,710,689 (GRCm38) R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 (GRCm38) M250L probably benign Het
Zc3h7a A T 16: 11,156,186 (GRCm38) V245D probably damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,010,127 (GRCm38) missense probably damaging 1.00
IGL00433:Reln APN 5 22,045,009 (GRCm38) missense probably damaging 1.00
IGL00576:Reln APN 5 22,154,950 (GRCm38) missense probably benign 0.01
IGL00755:Reln APN 5 22,060,380 (GRCm38) missense probably damaging 0.98
IGL00777:Reln APN 5 22,018,850 (GRCm38) critical splice donor site probably null
IGL00900:Reln APN 5 21,980,117 (GRCm38) missense probably damaging 0.98
IGL01067:Reln APN 5 21,979,666 (GRCm38) missense probably damaging 1.00
IGL01104:Reln APN 5 21,986,967 (GRCm38) missense probably damaging 0.99
IGL01141:Reln APN 5 21,969,033 (GRCm38) missense probably damaging 1.00
IGL01141:Reln APN 5 21,919,069 (GRCm38) missense probably damaging 1.00
IGL01333:Reln APN 5 22,171,251 (GRCm38) missense probably damaging 0.99
IGL01341:Reln APN 5 21,969,079 (GRCm38) missense probably damaging 1.00
IGL01354:Reln APN 5 21,919,175 (GRCm38) nonsense probably null
IGL01361:Reln APN 5 21,919,021 (GRCm38) missense probably benign 0.06
IGL01446:Reln APN 5 21,969,317 (GRCm38) missense probably damaging 0.99
IGL01448:Reln APN 5 22,040,405 (GRCm38) missense probably benign 0.40
IGL01612:Reln APN 5 21,896,930 (GRCm38) missense probably damaging 0.99
IGL01695:Reln APN 5 21,920,438 (GRCm38) missense probably damaging 1.00
IGL01718:Reln APN 5 21,947,514 (GRCm38) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,344,246 (GRCm38) nonsense probably null
IGL01875:Reln APN 5 21,904,717 (GRCm38) missense probably benign
IGL02013:Reln APN 5 21,950,879 (GRCm38) missense probably damaging 1.00
IGL02031:Reln APN 5 21,979,016 (GRCm38) missense probably damaging 0.99
IGL02186:Reln APN 5 21,909,958 (GRCm38) missense probably damaging 1.00
IGL02228:Reln APN 5 21,904,731 (GRCm38) missense probably damaging 0.99
IGL02248:Reln APN 5 21,910,992 (GRCm38) missense probably damaging 1.00
IGL02336:Reln APN 5 21,929,134 (GRCm38) missense probably damaging 1.00
IGL02352:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,039,565 (GRCm38) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,080,791 (GRCm38) nonsense probably null
IGL02408:Reln APN 5 21,901,619 (GRCm38) missense probably benign 0.44
IGL02415:Reln APN 5 21,971,951 (GRCm38) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,040,427 (GRCm38) missense probably benign 0.00
IGL02540:Reln APN 5 22,034,752 (GRCm38) missense probably damaging 0.96
IGL02624:Reln APN 5 22,103,357 (GRCm38) missense probably benign 0.09
IGL02720:Reln APN 5 21,997,941 (GRCm38) missense probably damaging 0.99
IGL02894:Reln APN 5 21,885,548 (GRCm38) missense possibly damaging 0.72
IGL02999:Reln APN 5 21,995,365 (GRCm38) missense probably damaging 1.00
IGL03125:Reln APN 5 21,910,844 (GRCm38) missense probably damaging 1.00
IGL03298:Reln APN 5 21,910,836 (GRCm38) missense probably damaging 0.99
Fishing UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
P0020:Reln UTSW 5 22,106,060 (GRCm38) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R0018:Reln UTSW 5 21,925,371 (GRCm38) missense probably benign 0.01
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0105:Reln UTSW 5 22,048,815 (GRCm38) missense probably damaging 0.99
R0127:Reln UTSW 5 22,004,136 (GRCm38) missense probably damaging 1.00
R0135:Reln UTSW 5 22,128,649 (GRCm38) missense probably damaging 0.99
R0144:Reln UTSW 5 21,948,449 (GRCm38) missense probably damaging 0.97
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0240:Reln UTSW 5 22,106,045 (GRCm38) missense probably benign 0.36
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0242:Reln UTSW 5 21,942,597 (GRCm38) critical splice donor site probably null
R0266:Reln UTSW 5 21,988,776 (GRCm38) missense probably damaging 1.00
R0269:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0280:Reln UTSW 5 22,227,513 (GRCm38) splice site probably benign
R0333:Reln UTSW 5 21,929,242 (GRCm38) missense probably damaging 0.97
R0357:Reln UTSW 5 21,950,822 (GRCm38) missense probably damaging 1.00
R0359:Reln UTSW 5 22,048,800 (GRCm38) missense probably damaging 0.98
R0506:Reln UTSW 5 21,920,496 (GRCm38) missense probably damaging 0.97
R0534:Reln UTSW 5 21,947,408 (GRCm38) missense probably damaging 0.99
R0535:Reln UTSW 5 22,051,276 (GRCm38) splice site probably benign
R0541:Reln UTSW 5 21,980,109 (GRCm38) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,010,150 (GRCm38) missense probably benign 0.36
R0617:Reln UTSW 5 21,920,537 (GRCm38) missense probably damaging 1.00
R0634:Reln UTSW 5 22,018,869 (GRCm38) missense probably damaging 1.00
R0653:Reln UTSW 5 21,913,230 (GRCm38) missense probably benign 0.44
R0704:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0706:Reln UTSW 5 21,896,811 (GRCm38) missense probably damaging 0.99
R0959:Reln UTSW 5 22,227,628 (GRCm38) missense probably damaging 0.96
R1066:Reln UTSW 5 22,034,664 (GRCm38) missense probably damaging 1.00
R1110:Reln UTSW 5 22,034,775 (GRCm38) missense probably benign
R1163:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R1222:Reln UTSW 5 21,986,955 (GRCm38) missense probably null 0.97
R1226:Reln UTSW 5 21,910,866 (GRCm38) missense probably damaging 1.00
R1440:Reln UTSW 5 22,128,602 (GRCm38) splice site probably benign
R1532:Reln UTSW 5 22,034,744 (GRCm38) missense probably damaging 0.99
R1552:Reln UTSW 5 21,960,378 (GRCm38) missense probably benign 0.01
R1565:Reln UTSW 5 21,925,213 (GRCm38) missense probably benign 0.05
R1618:Reln UTSW 5 22,060,368 (GRCm38) missense probably benign 0.01
R1636:Reln UTSW 5 21,998,683 (GRCm38) missense probably damaging 0.99
R1664:Reln UTSW 5 21,929,086 (GRCm38) missense probably damaging 1.00
R1716:Reln UTSW 5 21,955,095 (GRCm38) missense probably damaging 0.98
R1759:Reln UTSW 5 22,010,289 (GRCm38) missense probably damaging 0.99
R1835:Reln UTSW 5 21,979,002 (GRCm38) missense probably damaging 1.00
R1907:Reln UTSW 5 22,044,962 (GRCm38) critical splice donor site probably null
R1991:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2046:Reln UTSW 5 21,942,627 (GRCm38) missense probably benign 0.01
R2072:Reln UTSW 5 21,919,177 (GRCm38) missense probably damaging 1.00
R2103:Reln UTSW 5 21,969,360 (GRCm38) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,019,000 (GRCm38) missense probably damaging 1.00
R2120:Reln UTSW 5 21,969,085 (GRCm38) missense probably damaging 1.00
R2216:Reln UTSW 5 22,048,005 (GRCm38) missense probably benign 0.30
R2219:Reln UTSW 5 21,972,047 (GRCm38) missense possibly damaging 0.88
R2228:Reln UTSW 5 21,987,078 (GRCm38) missense possibly damaging 0.69
R2306:Reln UTSW 5 21,896,786 (GRCm38) missense probably damaging 1.00
R2316:Reln UTSW 5 22,154,956 (GRCm38) missense probably benign 0.00
R2321:Reln UTSW 5 21,915,020 (GRCm38) missense probably damaging 0.99
R2512:Reln UTSW 5 21,979,690 (GRCm38) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,344,369 (GRCm38) missense unknown
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,049,791 (GRCm38) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,040,420 (GRCm38) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,227,600 (GRCm38) missense possibly damaging 0.64
R3706:Reln UTSW 5 21,995,589 (GRCm38) splice site probably benign
R3713:Reln UTSW 5 21,904,734 (GRCm38) missense probably damaging 0.99
R3770:Reln UTSW 5 21,948,566 (GRCm38) missense probably damaging 1.00
R3836:Reln UTSW 5 21,911,014 (GRCm38) missense probably damaging 1.00
R3887:Reln UTSW 5 21,910,849 (GRCm38) missense possibly damaging 0.92
R3972:Reln UTSW 5 21,979,001 (GRCm38) missense probably damaging 0.99
R3975:Reln UTSW 5 21,995,366 (GRCm38) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,227,630 (GRCm38) missense probably benign 0.45
R4044:Reln UTSW 5 22,128,632 (GRCm38) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,034,584 (GRCm38) missense probably damaging 1.00
R4297:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4298:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4299:Reln UTSW 5 21,920,487 (GRCm38) missense probably damaging 0.99
R4518:Reln UTSW 5 21,901,743 (GRCm38) missense probably benign 0.44
R4615:Reln UTSW 5 21,972,872 (GRCm38) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,152,463 (GRCm38) missense probably benign 0.17
R4720:Reln UTSW 5 22,286,896 (GRCm38) missense possibly damaging 0.71
R4721:Reln UTSW 5 21,919,222 (GRCm38) missense probably damaging 0.99
R4771:Reln UTSW 5 22,049,700 (GRCm38) missense probably damaging 1.00
R4794:Reln UTSW 5 22,344,185 (GRCm38) missense probably damaging 0.98
R4840:Reln UTSW 5 22,018,846 (GRCm38) splice site probably null
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4860:Reln UTSW 5 21,901,751 (GRCm38) missense probably benign 0.06
R4896:Reln UTSW 5 21,955,238 (GRCm38) missense probably damaging 1.00
R4908:Reln UTSW 5 21,979,720 (GRCm38) missense probably benign 0.02
R4912:Reln UTSW 5 21,925,193 (GRCm38) missense probably benign 0.29
R4922:Reln UTSW 5 21,995,587 (GRCm38) critical splice acceptor site probably null
R4975:Reln UTSW 5 21,960,426 (GRCm38) missense probably damaging 1.00
R4976:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5020:Reln UTSW 5 22,034,638 (GRCm38) missense probably damaging 1.00
R5037:Reln UTSW 5 21,948,512 (GRCm38) missense probably damaging 1.00
R5082:Reln UTSW 5 21,896,077 (GRCm38) missense probably benign 0.00
R5119:Reln UTSW 5 21,971,870 (GRCm38) missense probably benign 0.05
R5125:Reln UTSW 5 21,913,241 (GRCm38) missense possibly damaging 0.78
R5137:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R5152:Reln UTSW 5 21,948,629 (GRCm38) missense probably damaging 1.00
R5154:Reln UTSW 5 21,988,765 (GRCm38) missense probably damaging 0.99
R5259:Reln UTSW 5 22,103,397 (GRCm38) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,011,163 (GRCm38) missense probably damaging 1.00
R5386:Reln UTSW 5 22,039,529 (GRCm38) missense probably benign
R5400:Reln UTSW 5 21,979,714 (GRCm38) missense probably damaging 1.00
R5478:Reln UTSW 5 22,004,203 (GRCm38) missense probably benign 0.00
R5514:Reln UTSW 5 21,971,885 (GRCm38) missense possibly damaging 0.93
R5529:Reln UTSW 5 21,932,715 (GRCm38) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,039,665 (GRCm38) nonsense probably null
R5648:Reln UTSW 5 21,998,572 (GRCm38) missense probably benign 0.04
R5649:Reln UTSW 5 21,901,625 (GRCm38) missense probably benign 0.33
R5744:Reln UTSW 5 22,106,083 (GRCm38) missense probably null 0.39
R5782:Reln UTSW 5 22,018,056 (GRCm38) missense probably benign 0.01
R5838:Reln UTSW 5 21,899,113 (GRCm38) missense probably damaging 0.97
R6162:Reln UTSW 5 21,911,050 (GRCm38) missense probably damaging 1.00
R6219:Reln UTSW 5 21,948,596 (GRCm38) missense probably damaging 1.00
R6259:Reln UTSW 5 22,060,333 (GRCm38) missense probably damaging 0.99
R6279:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6299:Reln UTSW 5 22,286,944 (GRCm38) missense possibly damaging 0.71
R6300:Reln UTSW 5 21,896,841 (GRCm38) missense probably damaging 1.00
R6314:Reln UTSW 5 22,152,484 (GRCm38) nonsense probably null
R6351:Reln UTSW 5 21,901,663 (GRCm38) nonsense probably null
R6369:Reln UTSW 5 22,051,361 (GRCm38) missense probably benign 0.03
R6371:Reln UTSW 5 21,995,513 (GRCm38) missense probably benign
R6374:Reln UTSW 5 22,080,714 (GRCm38) missense probably benign 0.06
R6425:Reln UTSW 5 21,911,020 (GRCm38) nonsense probably null
R6442:Reln UTSW 5 21,932,776 (GRCm38) missense probably benign
R6445:Reln UTSW 5 21,919,214 (GRCm38) missense probably benign 0.05
R6554:Reln UTSW 5 21,896,840 (GRCm38) missense probably damaging 1.00
R6641:Reln UTSW 5 21,929,134 (GRCm38) missense probably damaging 1.00
R6768:Reln UTSW 5 21,978,907 (GRCm38) missense probably damaging 0.99
R6859:Reln UTSW 5 22,034,570 (GRCm38) missense probably damaging 1.00
R6896:Reln UTSW 5 21,899,179 (GRCm38) missense probably benign 0.18
R6932:Reln UTSW 5 21,985,857 (GRCm38) missense probably benign 0.00
R6948:Reln UTSW 5 21,972,035 (GRCm38) missense probably damaging 1.00
R6959:Reln UTSW 5 21,976,564 (GRCm38) missense probably damaging 1.00
R7085:Reln UTSW 5 21,915,087 (GRCm38) nonsense probably null
R7091:Reln UTSW 5 21,899,029 (GRCm38) missense probably null 0.08
R7135:Reln UTSW 5 21,976,596 (GRCm38) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,106,097 (GRCm38) missense probably damaging 0.97
R7167:Reln UTSW 5 21,942,620 (GRCm38) missense probably damaging 1.00
R7190:Reln UTSW 5 22,047,947 (GRCm38) missense probably damaging 1.00
R7256:Reln UTSW 5 21,978,923 (GRCm38) missense probably benign 0.03
R7393:Reln UTSW 5 21,976,351 (GRCm38) missense probably damaging 0.99
R7399:Reln UTSW 5 22,051,367 (GRCm38) missense probably damaging 0.99
R7400:Reln UTSW 5 21,971,934 (GRCm38) missense probably damaging 0.99
R7426:Reln UTSW 5 21,971,953 (GRCm38) missense probably damaging 1.00
R7463:Reln UTSW 5 22,103,435 (GRCm38) missense probably damaging 0.98
R7470:Reln UTSW 5 21,942,741 (GRCm38) missense probably damaging 0.99
R7473:Reln UTSW 5 21,929,127 (GRCm38) missense probably benign 0.25
R7501:Reln UTSW 5 22,227,638 (GRCm38) missense possibly damaging 0.91
R7542:Reln UTSW 5 21,955,181 (GRCm38) missense probably damaging 1.00
R7544:Reln UTSW 5 21,976,278 (GRCm38) nonsense probably null
R7588:Reln UTSW 5 21,885,568 (GRCm38) missense probably benign 0.03
R7631:Reln UTSW 5 21,971,935 (GRCm38) missense probably damaging 0.97
R7644:Reln UTSW 5 21,978,931 (GRCm38) missense probably benign 0.39
R7834:Reln UTSW 5 22,039,635 (GRCm38) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,134,692 (GRCm38) missense probably benign 0.00
R7938:Reln UTSW 5 21,950,872 (GRCm38) missense probably damaging 0.97
R8006:Reln UTSW 5 21,899,084 (GRCm38) nonsense probably null
R8062:Reln UTSW 5 21,971,992 (GRCm38) missense probably benign 0.00
R8222:Reln UTSW 5 21,931,477 (GRCm38) nonsense probably null
R8266:Reln UTSW 5 22,018,087 (GRCm38) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,004,112 (GRCm38) missense probably damaging 1.00
R8487:Reln UTSW 5 21,899,029 (GRCm38) missense probably benign 0.03
R8523:Reln UTSW 5 22,004,231 (GRCm38) missense probably damaging 1.00
R8751:Reln UTSW 5 21,942,674 (GRCm38) missense probably benign 0.37
R8801:Reln UTSW 5 21,950,856 (GRCm38) missense possibly damaging 0.94
R8802:Reln UTSW 5 21,925,259 (GRCm38) missense probably damaging 0.98
R8978:Reln UTSW 5 21,885,514 (GRCm38) missense possibly damaging 0.85
R8988:Reln UTSW 5 21,899,157 (GRCm38) missense probably damaging 0.97
R8995:Reln UTSW 5 21,979,579 (GRCm38) missense probably benign 0.00
R9022:Reln UTSW 5 21,976,615 (GRCm38) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,048,038 (GRCm38) missense probably damaging 1.00
R9069:Reln UTSW 5 22,011,061 (GRCm38) missense probably damaging 1.00
R9089:Reln UTSW 5 21,925,200 (GRCm38) missense probably benign 0.01
R9126:Reln UTSW 5 21,955,196 (GRCm38) missense probably damaging 1.00
R9172:Reln UTSW 5 21,950,817 (GRCm38) critical splice donor site probably null
R9182:Reln UTSW 5 21,901,619 (GRCm38) missense probably benign 0.44
R9196:Reln UTSW 5 22,152,473 (GRCm38) missense probably damaging 1.00
R9211:Reln UTSW 5 22,344,202 (GRCm38) nonsense probably null
R9241:Reln UTSW 5 21,969,069 (GRCm38) missense probably damaging 0.99
R9244:Reln UTSW 5 21,915,153 (GRCm38) missense probably damaging 0.99
R9281:Reln UTSW 5 21,948,547 (GRCm38) missense probably damaging 1.00
R9295:Reln UTSW 5 22,004,211 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 21,988,707 (GRCm38) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,080,691 (GRCm38) missense probably benign 0.01
R9309:Reln UTSW 5 21,971,868 (GRCm38) missense probably benign 0.37
R9338:Reln UTSW 5 21,997,939 (GRCm38) missense probably damaging 0.98
R9381:Reln UTSW 5 22,344,204 (GRCm38) missense possibly damaging 0.93
R9430:Reln UTSW 5 21,915,107 (GRCm38) missense probably damaging 1.00
R9509:Reln UTSW 5 22,344,200 (GRCm38) missense possibly damaging 0.93
R9515:Reln UTSW 5 21,920,510 (GRCm38) missense possibly damaging 0.46
R9717:Reln UTSW 5 21,931,429 (GRCm38) missense probably benign 0.26
R9745:Reln UTSW 5 21,947,527 (GRCm38) missense probably damaging 1.00
R9778:Reln UTSW 5 21,950,945 (GRCm38) missense probably damaging 1.00
Z1176:Reln UTSW 5 21,979,024 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,004,082 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 21,969,241 (GRCm38) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,227,636 (GRCm38) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,154,959 (GRCm38) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGACACAGGTTCCAAACAGTCC -3'
(R):5'- ACCAGATCTGAGATGGCTGACAG -3'

Sequencing Primer
(F):5'- TGGACACCCAGGCTTCTGTAC -3'
(R):5'- GTTAAAACCCAAATCTGGGG -3'
Posted On 2016-12-20