Incidental Mutation 'R5815:Mphosph9'
ID 448992
Institutional Source Beutler Lab
Gene Symbol Mphosph9
Ensembl Gene ENSMUSG00000038126
Gene Name M-phase phosphoprotein 9
Synonyms MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5815 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124250959-124327972 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 124315418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 277 (L277R)
Ref Sequence ENSEMBL: ENSMUSP00000138982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031344
AA Change: L247R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: L247R

DomainStartEndE-ValueType
low complexity region 102 119 N/A INTRINSIC
low complexity region 128 140 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
coiled coil region 574 736 N/A INTRINSIC
low complexity region 879 898 N/A INTRINSIC
low complexity region 957 971 N/A INTRINSIC
coiled coil region 1040 1105 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130502
SMART Domains Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

DomainStartEndE-ValueType
low complexity region 47 74 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141203
Predicted Effect probably benign
Transcript: ENSMUST00000147737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156013
Predicted Effect probably damaging
Transcript: ENSMUST00000184951
AA Change: L277R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: L277R

DomainStartEndE-ValueType
coiled coil region 102 130 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 158 170 N/A INTRINSIC
low complexity region 444 458 N/A INTRINSIC
coiled coil region 604 766 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
low complexity region 987 1001 N/A INTRINSIC
coiled coil region 1070 1135 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Mphosph9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Mphosph9 APN 5 124262021 missense probably damaging 1.00
IGL01527:Mphosph9 APN 5 124283624 splice site probably benign
IGL01784:Mphosph9 APN 5 124265310 splice site probably benign
IGL01958:Mphosph9 APN 5 124324990 utr 5 prime probably benign
IGL02020:Mphosph9 APN 5 124258950 missense probably damaging 0.99
IGL02190:Mphosph9 APN 5 124265425 missense possibly damaging 0.92
IGL02261:Mphosph9 APN 5 124260087 missense probably damaging 1.00
IGL02569:Mphosph9 APN 5 124297571 nonsense probably null
IGL02640:Mphosph9 APN 5 124315500 missense possibly damaging 0.66
IGL02702:Mphosph9 APN 5 124259989 missense probably damaging 1.00
IGL02793:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL02813:Mphosph9 APN 5 124315628 missense probably benign 0.37
IGL02875:Mphosph9 APN 5 124283737 critical splice acceptor site probably null
IGL03149:Mphosph9 APN 5 124263011 missense probably damaging 1.00
PIT4445001:Mphosph9 UTSW 5 124298790 missense possibly damaging 0.82
R0304:Mphosph9 UTSW 5 124298829 missense probably benign 0.01
R0437:Mphosph9 UTSW 5 124315568 missense probably benign 0.27
R0483:Mphosph9 UTSW 5 124306970 nonsense probably null
R0811:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0812:Mphosph9 UTSW 5 124298759 missense probably damaging 1.00
R0942:Mphosph9 UTSW 5 124262037 nonsense probably null
R1175:Mphosph9 UTSW 5 124315676 missense possibly damaging 0.94
R1372:Mphosph9 UTSW 5 124283745 splice site probably null
R1442:Mphosph9 UTSW 5 124265398 missense possibly damaging 0.62
R1533:Mphosph9 UTSW 5 124267141 missense probably damaging 1.00
R1959:Mphosph9 UTSW 5 124315701 missense possibly damaging 0.92
R2036:Mphosph9 UTSW 5 124304211 missense probably damaging 0.97
R2256:Mphosph9 UTSW 5 124283659 missense probably benign 0.00
R2919:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R2920:Mphosph9 UTSW 5 124261006 missense probably benign 0.22
R4064:Mphosph9 UTSW 5 124290917 missense probably damaging 1.00
R4272:Mphosph9 UTSW 5 124304203 missense probably damaging 0.96
R4430:Mphosph9 UTSW 5 124265446 missense possibly damaging 0.83
R4883:Mphosph9 UTSW 5 124299045 missense probably damaging 1.00
R4992:Mphosph9 UTSW 5 124304190 missense probably damaging 1.00
R5993:Mphosph9 UTSW 5 124316098 missense probably benign 0.40
R6102:Mphosph9 UTSW 5 124297709 missense possibly damaging 0.86
R6295:Mphosph9 UTSW 5 124320915 missense possibly damaging 0.46
R6320:Mphosph9 UTSW 5 124324961 missense probably damaging 0.99
R6628:Mphosph9 UTSW 5 124298762 missense probably damaging 0.98
R6692:Mphosph9 UTSW 5 124260116 missense probably damaging 1.00
R6705:Mphosph9 UTSW 5 124290964 missense possibly damaging 0.83
R6747:Mphosph9 UTSW 5 124297699 missense possibly damaging 0.93
R6787:Mphosph9 UTSW 5 124261027 missense probably damaging 0.99
R6850:Mphosph9 UTSW 5 124260956 missense probably damaging 1.00
R6956:Mphosph9 UTSW 5 124297558 missense probably damaging 1.00
R7075:Mphosph9 UTSW 5 124320859 missense probably damaging 0.99
R7604:Mphosph9 UTSW 5 124316117 missense probably benign 0.01
R7789:Mphosph9 UTSW 5 124315587 missense probably damaging 1.00
R7808:Mphosph9 UTSW 5 124260946 missense probably damaging 0.99
R7823:Mphosph9 UTSW 5 124304256 missense probably damaging 0.99
R7891:Mphosph9 UTSW 5 124290904 missense probably damaging 1.00
R8210:Mphosph9 UTSW 5 124267111 missense probably damaging 1.00
R8256:Mphosph9 UTSW 5 124255106 missense probably damaging 1.00
R8385:Mphosph9 UTSW 5 124312722 missense probably benign 0.19
R8438:Mphosph9 UTSW 5 124292392 missense probably benign 0.19
R8692:Mphosph9 UTSW 5 124312812 missense probably damaging 0.99
R8790:Mphosph9 UTSW 5 124315673 missense probably damaging 1.00
R8818:Mphosph9 UTSW 5 124324964 nonsense probably null
R8847:Mphosph9 UTSW 5 124316146 missense possibly damaging 0.91
R9018:Mphosph9 UTSW 5 124298650 missense probably benign 0.12
R9208:Mphosph9 UTSW 5 124312791 missense probably damaging 0.97
R9221:Mphosph9 UTSW 5 124265364 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCGCATGTAACATGTAAGAGTCAG -3'
(R):5'- TGCATCCTGGACATGAACAC -3'

Sequencing Primer
(F):5'- AGAGTCAGATTTTAATGGTAAACCTG -3'
(R):5'- TAAGGAGCCCACCGAGC -3'
Posted On 2016-12-20