Mutagenetix > Incidental Mutation

Incidental Mutation 'R5815:Mphosph9'

448992

Institutional Source

Beutler Lab

Gene Symbol

Mphosph9

Ensembl Gene

ENSMUSG00000038126

Gene Name

M-phase phosphoprotein 9

Synonyms

MPP-9, MPP9, B930097C17Rik, 9630025B04Rik, 4930548D04Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5815 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124250959-124327972 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 124315418 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 277 (L277R)

Ref Sequence

ENSEMBL: ENSMUSP00000138982 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031344] [ENSMUST00000130502] [ENSMUST00000141203] [ENSMUST00000147737] [ENSMUST00000184951]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031344
AA Change: L247R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031344
Gene: ENSMUSG00000038126
AA Change: L247R

Domain	Start	End	E-Value	Type
low complexity region	102	119	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
low complexity region	414	428	N/A	INTRINSIC
coiled coil region	574	736	N/A	INTRINSIC
low complexity region	879	898	N/A	INTRINSIC
low complexity region	957	971	N/A	INTRINSIC
coiled coil region	1040	1105	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130502

SMART Domains

Protein: ENSMUSP00000120827
Gene: ENSMUSG00000038126

Domain	Start	End	E-Value	Type
low complexity region	47	74	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141203

Predicted Effect

probably benign
Transcript: ENSMUST00000147737

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149933

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156013

Predicted Effect

probably damaging
Transcript: ENSMUST00000184951
AA Change: L277R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000138982
Gene: ENSMUSG00000038126
AA Change: L277R

Domain	Start	End	E-Value	Type
coiled coil region	102	130	N/A	INTRINSIC
low complexity region	132	149	N/A	INTRINSIC
low complexity region	158	170	N/A	INTRINSIC
low complexity region	444	458	N/A	INTRINSIC
coiled coil region	604	766	N/A	INTRINSIC
low complexity region	909	928	N/A	INTRINSIC
low complexity region	987	1001	N/A	INTRINSIC
coiled coil region	1070	1135	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afmid	A	G	11: 117,835,704	D226G	probably benign	Het
Ago2	T	C	15: 73,107,366		probably null	Het
Aldh1a1	C	A	19: 20,630,670	D285E	probably benign	Het
Alms1	T	C	6: 85,622,838	S1549P	probably damaging	Het
Apmap	T	C	2: 150,600,251	S68G	probably benign	Het
Atp8a1	A	T	5: 67,749,071	I500N	probably benign	Het
B3gnt7	A	C	1: 86,305,788	D135A	probably benign	Het
Bms1	A	T	6: 118,404,279	L692H	probably damaging	Het
Cdk17	T	A	10: 93,228,697	V276E	probably damaging	Het
Cep290	A	T	10: 100,558,108	E2059V	possibly damaging	Het
Cpxm2	C	A	7: 132,044,110	G693V	probably damaging	Het
Crocc	A	T	4: 141,035,196	V661E	probably damaging	Het
D11Wsu47e	C	A	11: 113,687,957		probably null	Het
D1Pas1	A	T	1: 186,968,009	N45I	probably damaging	Het
Ddx19a	C	T	8: 110,979,149	W223*	probably null	Het
Ddx60	C	A	8: 61,963,722	S567Y	probably damaging	Het
Dhx36	A	T	3: 62,493,755	N363K	probably damaging	Het
Gpr151	G	A	18: 42,579,385	T76M	probably benign	Het
Inhbc	C	T	10: 127,357,449	V233I	probably benign	Het
Ippk	C	T	13: 49,446,363	L233F	probably damaging	Het
Lama2	A	G	10: 26,986,851	V2972A	probably damaging	Het
Lrrc37a	T	C	11: 103,503,786	Q271R	probably benign	Het
Mia2	A	T	12: 59,174,106	K1083N	possibly damaging	Het
Myo7b	A	T	18: 31,966,288	F1694I	probably damaging	Het
Obscn	T	C	11: 59,082,189		probably null	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1361	T	C	13: 21,658,537	Y262C	probably damaging	Het
Pcdh10	A	G	3: 45,392,721	T984A	probably benign	Het
Pcdh20	T	C	14: 88,470,876	S39G	probably benign	Het
Pdia3	T	A	2: 121,436,411	Y467*	probably null	Het
Ptpn13	C	A	5: 103,597,690		probably null	Het
Reln	A	G	5: 21,947,433	M2345T	probably damaging	Het
Rnf126	A	T	10: 79,766,769	I20N	probably benign	Het
Satb1	A	G	17: 51,782,953	S289P	possibly damaging	Het
Scd4	A	T	19: 44,337,564	H119L	probably damaging	Het
Sco2	T	C	15: 89,372,371	T27A	probably benign	Het
Slc39a14	A	T	14: 70,306,745	I464N	probably damaging	Het
Slc4a8	T	A	15: 100,788,211	V220E	probably benign	Het
Themis3	C	T	17: 66,555,704	V420I	possibly damaging	Het
Tmf1	T	A	6: 97,173,403	T448S	probably benign	Het
Tspan33	G	A	6: 29,710,689	R87Q	probably damaging	Het
Vmn2r91	A	T	17: 18,106,202	M250L	probably benign	Het
Zc3h7a	A	T	16: 11,156,186	V245D	probably damaging	Het

Other mutations in Mphosph9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01363:Mphosph9	APN	5	124262021	missense	probably damaging	1.00
IGL01527:Mphosph9	APN	5	124283624	splice site	probably benign
IGL01784:Mphosph9	APN	5	124265310	splice site	probably benign
IGL01958:Mphosph9	APN	5	124324990	utr 5 prime	probably benign
IGL02020:Mphosph9	APN	5	124258950	missense	probably damaging	0.99
IGL02190:Mphosph9	APN	5	124265425	missense	possibly damaging	0.92
IGL02261:Mphosph9	APN	5	124260087	missense	probably damaging	1.00
IGL02569:Mphosph9	APN	5	124297571	nonsense	probably null
IGL02640:Mphosph9	APN	5	124315500	missense	possibly damaging	0.66
IGL02702:Mphosph9	APN	5	124259989	missense	probably damaging	1.00
IGL02793:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL02813:Mphosph9	APN	5	124315628	missense	probably benign	0.37
IGL02875:Mphosph9	APN	5	124283737	critical splice acceptor site	probably null
IGL03149:Mphosph9	APN	5	124263011	missense	probably damaging	1.00
PIT4445001:Mphosph9	UTSW	5	124298790	missense	possibly damaging	0.82
R0304:Mphosph9	UTSW	5	124298829	missense	probably benign	0.01
R0437:Mphosph9	UTSW	5	124315568	missense	probably benign	0.27
R0483:Mphosph9	UTSW	5	124306970	nonsense	probably null
R0811:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0812:Mphosph9	UTSW	5	124298759	missense	probably damaging	1.00
R0942:Mphosph9	UTSW	5	124262037	nonsense	probably null
R1175:Mphosph9	UTSW	5	124315676	missense	possibly damaging	0.94
R1372:Mphosph9	UTSW	5	124283745	splice site	probably null
R1442:Mphosph9	UTSW	5	124265398	missense	possibly damaging	0.62
R1533:Mphosph9	UTSW	5	124267141	missense	probably damaging	1.00
R1959:Mphosph9	UTSW	5	124315701	missense	possibly damaging	0.92
R2036:Mphosph9	UTSW	5	124304211	missense	probably damaging	0.97
R2256:Mphosph9	UTSW	5	124283659	missense	probably benign	0.00
R2919:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R2920:Mphosph9	UTSW	5	124261006	missense	probably benign	0.22
R4064:Mphosph9	UTSW	5	124290917	missense	probably damaging	1.00
R4272:Mphosph9	UTSW	5	124304203	missense	probably damaging	0.96
R4430:Mphosph9	UTSW	5	124265446	missense	possibly damaging	0.83
R4883:Mphosph9	UTSW	5	124299045	missense	probably damaging	1.00
R4992:Mphosph9	UTSW	5	124304190	missense	probably damaging	1.00
R5993:Mphosph9	UTSW	5	124316098	missense	probably benign	0.40
R6102:Mphosph9	UTSW	5	124297709	missense	possibly damaging	0.86
R6295:Mphosph9	UTSW	5	124320915	missense	possibly damaging	0.46
R6320:Mphosph9	UTSW	5	124324961	missense	probably damaging	0.99
R6628:Mphosph9	UTSW	5	124298762	missense	probably damaging	0.98
R6692:Mphosph9	UTSW	5	124260116	missense	probably damaging	1.00
R6705:Mphosph9	UTSW	5	124290964	missense	possibly damaging	0.83
R6747:Mphosph9	UTSW	5	124297699	missense	possibly damaging	0.93
R6787:Mphosph9	UTSW	5	124261027	missense	probably damaging	0.99
R6850:Mphosph9	UTSW	5	124260956	missense	probably damaging	1.00
R6956:Mphosph9	UTSW	5	124297558	missense	probably damaging	1.00
R7075:Mphosph9	UTSW	5	124320859	missense	probably damaging	0.99
R7604:Mphosph9	UTSW	5	124316117	missense	probably benign	0.01
R7789:Mphosph9	UTSW	5	124315587	missense	probably damaging	1.00
R7808:Mphosph9	UTSW	5	124260946	missense	probably damaging	0.99
R7823:Mphosph9	UTSW	5	124304256	missense	probably damaging	0.99
R7891:Mphosph9	UTSW	5	124290904	missense	probably damaging	1.00
R8210:Mphosph9	UTSW	5	124267111	missense	probably damaging	1.00
R8256:Mphosph9	UTSW	5	124255106	missense	probably damaging	1.00
R8385:Mphosph9	UTSW	5	124312722	missense	probably benign	0.19
R8438:Mphosph9	UTSW	5	124292392	missense	probably benign	0.19
R8692:Mphosph9	UTSW	5	124312812	missense	probably damaging	0.99
R8790:Mphosph9	UTSW	5	124315673	missense	probably damaging	1.00
R8818:Mphosph9	UTSW	5	124324964	nonsense	probably null
R8847:Mphosph9	UTSW	5	124316146	missense	possibly damaging	0.91
R9018:Mphosph9	UTSW	5	124298650	missense	probably benign	0.12
R9208:Mphosph9	UTSW	5	124312791	missense	probably damaging	0.97
R9221:Mphosph9	UTSW	5	124265364	missense	probably benign	0.10
R9603:Mphosph9	UTSW	5	124324952	nonsense	probably null
R9721:Mphosph9	UTSW	5	124298675	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- CCGCATGTAACATGTAAGAGTCAG -3'
(R):5'- TGCATCCTGGACATGAACAC -3'

Sequencing Primer
(F):5'- AGAGTCAGATTTTAATGGTAAACCTG -3'
(R):5'- TAAGGAGCCCACCGAGC -3'

Posted On

2016-12-20