Incidental Mutation 'R5815:Tspan33'
ID448993
Institutional Source Beutler Lab
Gene Symbol Tspan33
Ensembl Gene ENSMUSG00000001763
Gene Nametetraspanin 33
SynonymsPenumbra, 1300010A20Rik, Pen
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5815 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location29694222-29718559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29710689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 87 (R87Q)
Ref Sequence ENSEMBL: ENSMUSP00000110905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046750] [ENSMUST00000115250]
Predicted Effect probably damaging
Transcript: ENSMUST00000046750
AA Change: R88Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045282
Gene: ENSMUSG00000001763
AA Change: R88Q

DomainStartEndE-ValueType
Pfam:Tetraspannin 21 264 3.8e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115250
AA Change: R87Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110905
Gene: ENSMUSG00000001763
AA Change: R87Q

DomainStartEndE-ValueType
Pfam:Tetraspannin 21 263 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137925
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the tetraspanin family which typically have four transmembrane domains. The encoded protein may be involved in the regulation of erythropoiesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a null mutation display anemia and partial penetrance of red blood cell abnormalities, splenomegaly, monocytosis, thrombocytopenia, reticulocytosis, and extramedullary hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Tspan33
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0227:Tspan33 UTSW 6 29713478 missense probably damaging 0.96
R0329:Tspan33 UTSW 6 29711092 critical splice donor site probably null
R0330:Tspan33 UTSW 6 29711092 critical splice donor site probably null
R1554:Tspan33 UTSW 6 29711082 missense possibly damaging 0.84
R2078:Tspan33 UTSW 6 29709971 missense probably benign
R5705:Tspan33 UTSW 6 29717233 missense probably benign 0.07
R7101:Tspan33 UTSW 6 29716784 missense probably benign 0.02
R7375:Tspan33 UTSW 6 29713520 missense probably benign 0.17
R7535:Tspan33 UTSW 6 29717589 missense possibly damaging 0.48
R7570:Tspan33 UTSW 6 29717338 missense probably damaging 1.00
RF011:Tspan33 UTSW 6 29716730 missense probably damaging 1.00
RF049:Tspan33 UTSW 6 29709998 critical splice donor site probably benign
X0020:Tspan33 UTSW 6 29694533 missense probably benign 0.00
X0020:Tspan33 UTSW 6 29710631 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCACCAGACAAGGAGGTTC -3'
(R):5'- AATGCTATGGAGGTGGCCAC -3'

Sequencing Primer
(F):5'- CCCCCAGAACAGGAAGAAAGTTTG -3'
(R):5'- TACGCTGCCACCCAGAG -3'
Posted On2016-12-20