Mutagenetix > Incidental Mutations

Incidental Mutation 'R5815:Ddx60'

448998

Institutional Source

Beutler Lab

Gene Symbol

Ddx60

Ensembl Gene

ENSMUSG00000037921

Gene Name

DEAD (Asp-Glu-Ala-Asp) box polypeptide 60

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R5815 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61928087-62038244 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 61963722 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 567 (S567Y)

Ref Sequence

ENSEMBL: ENSMUSP00000122841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485] [ENSMUST00000154398]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000070631
AA Change: S567Y

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: S567Y

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	758	949	1.05e-15	SMART
Blast:DEXDc	1007	1132	4e-24	BLAST
HELICc	1245	1328	4.35e-13	SMART
low complexity region	1362	1373	N/A	INTRINSIC
Blast:DEXDc	1503	1584	1e-20	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000093485
AA Change: S568Y

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: S568Y

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC
DEXDc	759	950	1.05e-15	SMART
Blast:DEXDc	1008	1133	4e-24	BLAST
HELICc	1246	1329	4.35e-13	SMART
low complexity region	1363	1374	N/A	INTRINSIC
Blast:DEXDc	1504	1585	1e-20	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000154398
AA Change: S567Y

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122841
Gene: ENSMUSG00000037921
AA Change: S567Y

Domain	Start	End	E-Value	Type
low complexity region	99	110	N/A	INTRINSIC
low complexity region	364	376	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afmid	A	G	11: 117,835,704	D226G	probably benign	Het
Ago2	T	C	15: 73,107,366		probably null	Het
Aldh1a1	C	A	19: 20,630,670	D285E	probably benign	Het
Alms1	T	C	6: 85,622,838	S1549P	probably damaging	Het
Apmap	T	C	2: 150,600,251	S68G	probably benign	Het
Atp8a1	A	T	5: 67,749,071	I500N	probably benign	Het
B3gnt7	A	C	1: 86,305,788	D135A	probably benign	Het
Bms1	A	T	6: 118,404,279	L692H	probably damaging	Het
Cdk17	T	A	10: 93,228,697	V276E	probably damaging	Het
Cep290	A	T	10: 100,558,108	E2059V	possibly damaging	Het
Cpxm2	C	A	7: 132,044,110	G693V	probably damaging	Het
Crocc	A	T	4: 141,035,196	V661E	probably damaging	Het
D11Wsu47e	C	A	11: 113,687,957		probably null	Het
D1Pas1	A	T	1: 186,968,009	N45I	probably damaging	Het
Ddx19a	C	T	8: 110,979,149	W223*	probably null	Het
Dhx36	A	T	3: 62,493,755	N363K	probably damaging	Het
Gpr151	G	A	18: 42,579,385	T76M	probably benign	Het
Inhbc	C	T	10: 127,357,449	V233I	probably benign	Het
Ippk	C	T	13: 49,446,363	L233F	probably damaging	Het
Lama2	A	G	10: 26,986,851	V2972A	probably damaging	Het
Lrrc37a	T	C	11: 103,503,786	Q271R	probably benign	Het
Mia2	A	T	12: 59,174,106	K1083N	possibly damaging	Het
Mphosph9	A	C	5: 124,315,418	L277R	probably damaging	Het
Myo7b	A	T	18: 31,966,288	F1694I	probably damaging	Het
Obscn	T	C	11: 59,082,189		probably null	Het
Olfr1	AGCGGTCGTAGGC	AGC	11: 73,395,654		probably null	Het
Olfr1361	T	C	13: 21,658,537	Y262C	probably damaging	Het
Pcdh10	A	G	3: 45,392,721	T984A	probably benign	Het
Pcdh20	T	C	14: 88,470,876	S39G	probably benign	Het
Pdia3	T	A	2: 121,436,411	Y467*	probably null	Het
Ptpn13	C	A	5: 103,597,690		probably null	Het
Reln	A	G	5: 21,947,433	M2345T	probably damaging	Het
Rnf126	A	T	10: 79,766,769	I20N	probably benign	Het
Satb1	A	G	17: 51,782,953	S289P	possibly damaging	Het
Scd4	A	T	19: 44,337,564	H119L	probably damaging	Het
Sco2	T	C	15: 89,372,371	T27A	probably benign	Het
Slc39a14	A	T	14: 70,306,745	I464N	probably damaging	Het
Slc4a8	T	A	15: 100,788,211	V220E	probably benign	Het
Themis3	C	T	17: 66,555,704	V420I	possibly damaging	Het
Tmf1	T	A	6: 97,173,403	T448S	probably benign	Het
Tspan33	G	A	6: 29,710,689	R87Q	probably damaging	Het
Vmn2r91	A	T	17: 18,106,202	M250L	probably benign	Het
Zc3h7a	A	T	16: 11,156,186	V245D	probably damaging	Het

Other mutations in Ddx60

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Ddx60	APN	8	61958646	missense	probably damaging	1.00
IGL00915:Ddx60	APN	8	61987431	missense	possibly damaging	0.79
IGL00931:Ddx60	APN	8	61969583	missense	probably benign	0.18
IGL01023:Ddx60	APN	8	61942514	missense	probably damaging	0.99
IGL01313:Ddx60	APN	8	61982526	missense	probably damaging	1.00
IGL01615:Ddx60	APN	8	61963740	missense	probably null	0.81
IGL01733:Ddx60	APN	8	61983865	missense	probably damaging	0.99
IGL01779:Ddx60	APN	8	62017823	missense	possibly damaging	0.94
IGL01900:Ddx60	APN	8	62000709	splice site	probably benign
IGL02110:Ddx60	APN	8	62017247	critical splice donor site	probably null
IGL02302:Ddx60	APN	8	61975832	missense	possibly damaging	0.85
IGL02468:Ddx60	APN	8	61958642	missense	probably damaging	1.00
IGL02569:Ddx60	APN	8	62024951	missense	possibly damaging	0.93
IGL02622:Ddx60	APN	8	61942436	splice site	probably null
IGL02657:Ddx60	APN	8	61984115	missense	probably benign	0.01
IGL02677:Ddx60	APN	8	61988132	missense	probably damaging	1.00
IGL02701:Ddx60	APN	8	61979341	missense	probably damaging	0.96
IGL02806:Ddx60	APN	8	61956122	missense	probably benign	0.00
IGL03137:Ddx60	APN	8	61988083	missense	possibly damaging	0.61
IGL03295:Ddx60	APN	8	61956121	missense	possibly damaging	0.82
IGL03387:Ddx60	APN	8	62012449	missense	probably damaging	1.00
IGL03411:Ddx60	APN	8	61977882	critical splice acceptor site	probably null
PIT4504001:Ddx60	UTSW	8	61958113	missense	probably benign
PIT4677001:Ddx60	UTSW	8	61972254	missense	possibly damaging	0.87
R0090:Ddx60	UTSW	8	61942293	missense	probably damaging	1.00
R0266:Ddx60	UTSW	8	62033493	missense	possibly damaging	0.92
R0325:Ddx60	UTSW	8	61983855	missense	probably benign	0.00
R0367:Ddx60	UTSW	8	62017749	missense	possibly damaging	0.78
R0403:Ddx60	UTSW	8	61994541	splice site	probably benign
R0479:Ddx60	UTSW	8	61969657	missense	probably damaging	1.00
R0561:Ddx60	UTSW	8	62017794	missense	possibly damaging	0.93
R0844:Ddx60	UTSW	8	61987361	missense	probably benign	0.27
R1119:Ddx60	UTSW	8	61942544	missense	probably damaging	1.00
R1428:Ddx60	UTSW	8	61958159	splice site	probably benign
R1778:Ddx60	UTSW	8	61974176	missense	possibly damaging	0.85
R1840:Ddx60	UTSW	8	61969553	missense	probably damaging	0.99
R1964:Ddx60	UTSW	8	61948869	missense	probably benign	0.10
R1970:Ddx60	UTSW	8	61972206	missense	possibly damaging	0.93
R2101:Ddx60	UTSW	8	61940645	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	61956141	missense	probably damaging	1.00
R2174:Ddx60	UTSW	8	62017200	missense	probably benign	0.01
R2198:Ddx60	UTSW	8	61958063	missense	possibly damaging	0.79
R2332:Ddx60	UTSW	8	62037091	missense	probably benign	0.08
R2338:Ddx60	UTSW	8	62012436	missense	possibly damaging	0.91
R2379:Ddx60	UTSW	8	62037088	missense	probably damaging	1.00
R4010:Ddx60	UTSW	8	61954535	missense	possibly damaging	0.65
R4010:Ddx60	UTSW	8	61956144	missense	probably benign	0.25
R4133:Ddx60	UTSW	8	61972220	missense	probably damaging	0.99
R4282:Ddx60	UTSW	8	61994393	missense	probably damaging	0.99
R4382:Ddx60	UTSW	8	61948978	splice site	probably null
R4561:Ddx60	UTSW	8	61942461	missense	probably damaging	0.96
R4572:Ddx60	UTSW	8	61987421	missense	probably damaging	1.00
R4581:Ddx60	UTSW	8	62023261	missense	possibly damaging	0.90
R4635:Ddx60	UTSW	8	62037067	missense	probably benign	0.28
R4698:Ddx60	UTSW	8	62012424	missense	probably benign	0.01
R4807:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R4858:Ddx60	UTSW	8	62021314	missense	possibly damaging	0.80
R4964:Ddx60	UTSW	8	61979338	missense	probably damaging	1.00
R5120:Ddx60	UTSW	8	61945906	missense	probably benign	0.01
R5187:Ddx60	UTSW	8	61974188	missense	probably damaging	1.00
R5222:Ddx60	UTSW	8	61984158	missense	probably damaging	0.99
R5400:Ddx60	UTSW	8	62010002	missense	possibly damaging	0.65
R5500:Ddx60	UTSW	8	61950451	missense	probably benign	0.28
R5514:Ddx60	UTSW	8	61958057	missense	probably damaging	1.00
R5668:Ddx60	UTSW	8	62000578	missense	probably benign	0.38
R5742:Ddx60	UTSW	8	61948921	missense	probably benign
R5772:Ddx60	UTSW	8	61948897	missense	probably damaging	1.00
R5810:Ddx60	UTSW	8	62012388	nonsense	probably null
R5820:Ddx60	UTSW	8	61956121	missense	possibly damaging	0.82
R5866:Ddx60	UTSW	8	61940740	missense	probably damaging	1.00
R5881:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R5977:Ddx60	UTSW	8	62021410	critical splice donor site	probably null
R6048:Ddx60	UTSW	8	62000582	missense	probably benign	0.01
R6061:Ddx60	UTSW	8	62023241	missense	probably null	0.01
R6153:Ddx60	UTSW	8	61945940	missense	possibly damaging	0.47
R6287:Ddx60	UTSW	8	61950578	missense	probably damaging	1.00
R6415:Ddx60	UTSW	8	61983905	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61977950	missense	probably benign	0.00
R6416:Ddx60	UTSW	8	61998681	missense	probably benign
R6660:Ddx60	UTSW	8	61956239	missense	probably benign	0.00
R6694:Ddx60	UTSW	8	62037070	missense	probably damaging	1.00
R6715:Ddx60	UTSW	8	61983890	missense	probably benign	0.03
R6720:Ddx60	UTSW	8	62000689	missense	probably benign	0.10
R6937:Ddx60	UTSW	8	62037069	missense	probably damaging	1.00
R7153:Ddx60	UTSW	8	61988108	missense	possibly damaging	0.71
R7274:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R7409:Ddx60	UTSW	8	61958578	missense	probably benign	0.24
R7464:Ddx60	UTSW	8	61940674	missense	possibly damaging	0.82
R7670:Ddx60	UTSW	8	61975792	missense	probably damaging	1.00
R7904:Ddx60	UTSW	8	61977890	missense	possibly damaging	0.81
R7992:Ddx60	UTSW	8	61954535	missense	probably benign	0.03
R8124:Ddx60	UTSW	8	61983911	missense	probably benign
R8125:Ddx60	UTSW	8	61983911	missense	probably benign
R8126:Ddx60	UTSW	8	61983911	missense	probably benign
R8155:Ddx60	UTSW	8	62017171	missense	possibly damaging	0.61
R8174:Ddx60	UTSW	8	62017250	splice site	probably null
R8192:Ddx60	UTSW	8	61977968	missense	probably damaging	1.00
R8271:Ddx60	UTSW	8	61940108	critical splice donor site	probably null
R8301:Ddx60	UTSW	8	62000597	missense	probably benign	0.01
R8304:Ddx60	UTSW	8	61998769	missense	possibly damaging	0.67
R8319:Ddx60	UTSW	8	61942635	critical splice donor site	probably null
R8374:Ddx60	UTSW	8	61974171	missense	probably benign	0.01
R8401:Ddx60	UTSW	8	61956243	missense	possibly damaging	0.57
R8487:Ddx60	UTSW	8	61974150	missense	probably damaging	1.00
R8804:Ddx60	UTSW	8	61958606	missense	probably benign	0.27
X0003:Ddx60	UTSW	8	62033417	missense	possibly damaging	0.88
X0019:Ddx60	UTSW	8	61963692	missense	probably benign	0.01
Z1177:Ddx60	UTSW	8	62000588	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- AACCTGTGTGCATGGATTACTAG -3'
(R):5'- TGTCAGGGCATCCAAGAATC -3'

Sequencing Primer
(F):5'- TTTAGAGAGATGCTACTAAGAAACCG -3'
(R):5'- GTCCAACAGTGTTGCCAACTGAG -3'

Posted On

2016-12-20