Incidental Mutation 'R5815:Sco2'
ID449015
Institutional Source Beutler Lab
Gene Symbol Sco2
Ensembl Gene ENSMUSG00000091780
Gene NameSCO2 cytochrome c oxidase assembly protein
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5815 (G1)
Quality Score187
Status Not validated
Chromosome15
Chromosomal Location89371637-89373846 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89372371 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000155150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023285] [ENSMUST00000036987] [ENSMUST00000074552] [ENSMUST00000088717] [ENSMUST00000145259] [ENSMUST00000167643] [ENSMUST00000228977]
Predicted Effect probably benign
Transcript: ENSMUST00000023285
SMART Domains Protein: ENSMUSP00000023285
Gene: ENSMUSG00000022615

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Glycos_trans_3N 23 85 1.5e-20 PFAM
Pfam:Glycos_transf_3 95 326 3.1e-50 PFAM
PYNP_C 374 448 6.46e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036987
SMART Domains Protein: ENSMUSP00000036900
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 20 576 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074552
SMART Domains Protein: ENSMUSP00000074139
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:DUF1032 51 607 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088717
SMART Domains Protein: ENSMUSP00000086095
Gene: ENSMUSG00000008690

DomainStartEndE-ValueType
Pfam:CNDH2_N 11 123 1.2e-48 PFAM
Pfam:CNDH2_M 147 285 2.1e-20 PFAM
Pfam:CNDH2_C 308 598 1.9e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140665
Predicted Effect probably benign
Transcript: ENSMUST00000145259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151523
Predicted Effect probably benign
Transcript: ENSMUST00000167643
AA Change: T27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131943
Gene: ENSMUSG00000091780
AA Change: T27A

DomainStartEndE-ValueType
Pfam:SCO1-SenC 52 234 1.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228977
AA Change: T27A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice heterozygous for a knock-out allele and a knock-in allele exhibit muscle weakness and reduced exercise endurance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Sco2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01148:Sco2 APN 15 89371721 missense probably benign 0.02
R2020:Sco2 UTSW 15 89371860 missense probably damaging 1.00
R3811:Sco2 UTSW 15 89373679 utr 5 prime probably benign
R3812:Sco2 UTSW 15 89373679 utr 5 prime probably benign
R5686:Sco2 UTSW 15 89371972 nonsense probably null
R7421:Sco2 UTSW 15 89371720 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTAGGCTGAAGTCACCCTG -3'
(R):5'- TAACCTGCTTGAATGTGGGG -3'

Sequencing Primer
(F):5'- TGAAGTCACCCTGGCCCAC -3'
(R):5'- GGGCAGATGCTTGTCCAG -3'
Posted On2016-12-20