Incidental Mutation 'R5815:Slc4a8'
ID449016
Institutional Source Beutler Lab
Gene Symbol Slc4a8
Ensembl Gene ENSMUSG00000023032
Gene Namesolute carrier family 4 (anion exchanger), member 8
SynonymsNDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R5815 (G1)
Quality Score212
Status Not validated
Chromosome15
Chromosomal Location100761747-100823968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100788211 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 220 (V220E)
Ref Sequence ENSEMBL: ENSMUSP00000125090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]
Predicted Effect probably benign
Transcript: ENSMUST00000023776
AA Change: V272E

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032
AA Change: V272E

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Pfam:Band_3_cyto 145 402 1.4e-105 PFAM
Pfam:HCO3_cotransp 443 956 9.6e-247 PFAM
transmembrane domain 964 986 N/A INTRINSIC
low complexity region 1010 1027 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162049
AA Change: V220E

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032
AA Change: V220E

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
Pfam:Band_3_cyto 93 350 6.5e-103 PFAM
Pfam:HCO3_cotransp 390 904 1.6e-251 PFAM
transmembrane domain 912 934 N/A INTRINSIC
low complexity region 958 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Vmn2r91 A T 17: 18,106,202 M250L probably benign Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Slc4a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Slc4a8 APN 15 100807438 missense possibly damaging 0.50
IGL01633:Slc4a8 APN 15 100787247 missense probably damaging 1.00
IGL02945:Slc4a8 APN 15 100807199 critical splice acceptor site probably null
IGL03172:Slc4a8 APN 15 100799717 missense probably benign
R0008:Slc4a8 UTSW 15 100800493 missense possibly damaging 0.67
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0257:Slc4a8 UTSW 15 100784880 splice site probably benign
R0393:Slc4a8 UTSW 15 100774638 missense probably damaging 0.99
R0508:Slc4a8 UTSW 15 100789092 missense probably benign 0.01
R0639:Slc4a8 UTSW 15 100796550 missense probably damaging 1.00
R1640:Slc4a8 UTSW 15 100783787 missense probably benign 0.13
R1692:Slc4a8 UTSW 15 100800573 missense probably damaging 1.00
R1766:Slc4a8 UTSW 15 100787212 missense probably benign 0.00
R1955:Slc4a8 UTSW 15 100807376 missense probably damaging 1.00
R2157:Slc4a8 UTSW 15 100806373 missense probably damaging 1.00
R2206:Slc4a8 UTSW 15 100807445 missense probably damaging 1.00
R2229:Slc4a8 UTSW 15 100809299 missense probably damaging 1.00
R2274:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R2275:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R4299:Slc4a8 UTSW 15 100796640 critical splice donor site probably null
R4482:Slc4a8 UTSW 15 100810599 missense probably damaging 1.00
R5038:Slc4a8 UTSW 15 100795821 missense probably damaging 0.98
R5586:Slc4a8 UTSW 15 100787164 missense probably damaging 1.00
R5594:Slc4a8 UTSW 15 100795887 missense probably damaging 1.00
R5804:Slc4a8 UTSW 15 100791625 missense possibly damaging 0.71
R5921:Slc4a8 UTSW 15 100814447 splice site probably benign
R6029:Slc4a8 UTSW 15 100807339 missense probably benign 0.00
R6212:Slc4a8 UTSW 15 100811571 missense possibly damaging 0.69
R6321:Slc4a8 UTSW 15 100789164 missense probably damaging 0.99
R6574:Slc4a8 UTSW 15 100807316 missense probably damaging 1.00
R6829:Slc4a8 UTSW 15 100800538 missense probably damaging 1.00
R7023:Slc4a8 UTSW 15 100791643 missense probably benign 0.00
R7082:Slc4a8 UTSW 15 100791027 missense probably damaging 1.00
R7197:Slc4a8 UTSW 15 100790976 missense probably damaging 1.00
R7352:Slc4a8 UTSW 15 100790984 missense probably damaging 1.00
R7391:Slc4a8 UTSW 15 100784862 missense probably damaging 0.98
R7627:Slc4a8 UTSW 15 100788223 missense probably benign 0.08
R7810:Slc4a8 UTSW 15 100798178 missense possibly damaging 0.72
R8026:Slc4a8 UTSW 15 100787289 missense possibly damaging 0.72
Z1088:Slc4a8 UTSW 15 100761951 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACCATTAAGTGCGTGGGG -3'
(R):5'- ACCGTCCTGACAACTTGAAG -3'

Sequencing Primer
(F):5'- GACAGGTGTGAAGGGACCCTG -3'
(R):5'- CCGTCCTGACAACTTGAAGATGAG -3'
Posted On2016-12-20