Incidental Mutation 'R5815:Vmn2r91'
ID449018
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5815 (G1)
Quality Score192
Status Not validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18106202 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 250 (M250L)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably benign
Transcript: ENSMUST00000172359
AA Change: M250L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: M250L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afmid A G 11: 117,835,704 D226G probably benign Het
Ago2 T C 15: 73,107,366 probably null Het
Aldh1a1 C A 19: 20,630,670 D285E probably benign Het
Alms1 T C 6: 85,622,838 S1549P probably damaging Het
Apmap T C 2: 150,600,251 S68G probably benign Het
Atp8a1 A T 5: 67,749,071 I500N probably benign Het
B3gnt7 A C 1: 86,305,788 D135A probably benign Het
Bms1 A T 6: 118,404,279 L692H probably damaging Het
Cdk17 T A 10: 93,228,697 V276E probably damaging Het
Cep290 A T 10: 100,558,108 E2059V possibly damaging Het
Cpxm2 C A 7: 132,044,110 G693V probably damaging Het
Crocc A T 4: 141,035,196 V661E probably damaging Het
D11Wsu47e C A 11: 113,687,957 probably null Het
D1Pas1 A T 1: 186,968,009 N45I probably damaging Het
Ddx19a C T 8: 110,979,149 W223* probably null Het
Ddx60 C A 8: 61,963,722 S567Y probably damaging Het
Dhx36 A T 3: 62,493,755 N363K probably damaging Het
Gpr151 G A 18: 42,579,385 T76M probably benign Het
Inhbc C T 10: 127,357,449 V233I probably benign Het
Ippk C T 13: 49,446,363 L233F probably damaging Het
Lama2 A G 10: 26,986,851 V2972A probably damaging Het
Lrrc37a T C 11: 103,503,786 Q271R probably benign Het
Mia2 A T 12: 59,174,106 K1083N possibly damaging Het
Mphosph9 A C 5: 124,315,418 L277R probably damaging Het
Myo7b A T 18: 31,966,288 F1694I probably damaging Het
Obscn T C 11: 59,082,189 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1361 T C 13: 21,658,537 Y262C probably damaging Het
Pcdh10 A G 3: 45,392,721 T984A probably benign Het
Pcdh20 T C 14: 88,470,876 S39G probably benign Het
Pdia3 T A 2: 121,436,411 Y467* probably null Het
Ptpn13 C A 5: 103,597,690 probably null Het
Reln A G 5: 21,947,433 M2345T probably damaging Het
Rnf126 A T 10: 79,766,769 I20N probably benign Het
Satb1 A G 17: 51,782,953 S289P possibly damaging Het
Scd4 A T 19: 44,337,564 H119L probably damaging Het
Sco2 T C 15: 89,372,371 T27A probably benign Het
Slc39a14 A T 14: 70,306,745 I464N probably damaging Het
Slc4a8 T A 15: 100,788,211 V220E probably benign Het
Themis3 C T 17: 66,555,704 V420I possibly damaging Het
Tmf1 T A 6: 97,173,403 T448S probably benign Het
Tspan33 G A 6: 29,710,689 R87Q probably damaging Het
Zc3h7a A T 16: 11,156,186 V245D probably damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7397:Vmn2r91 UTSW 17 18135798 missense probably benign 0.02
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TTGGACCTTATGATCCTCTCTTGAG -3'
(R):5'- CAGCTGTGTCTATAACATGATGTTC -3'

Sequencing Primer
(F):5'- ATGATCCTCTCTTGAGTGACCATAG -3'
(R):5'- GTTCAATGTTCATGACCCAGAC -3'
Posted On2016-12-20