Incidental Mutation 'R5816:Prmt8'
ID449041
Institutional Source Beutler Lab
Gene Symbol Prmt8
Ensembl Gene ENSMUSG00000030350
Gene Nameprotein arginine N-methyltransferase 8
SynonymsHrmt1l3, Hrmt1l4
MMRRC Submission 043214-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5816 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location127689011-127769472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 127697738 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 309 (T309I)
Ref Sequence ENSEMBL: ENSMUSP00000032500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032500]
Predicted Effect probably benign
Transcript: ENSMUST00000032500
AA Change: T309I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032500
Gene: ENSMUSG00000030350
AA Change: T309I

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:PRMT5 80 368 4.5e-7 PFAM
Pfam:PrmA 102 200 2e-10 PFAM
Pfam:Methyltransf_31 110 274 7.3e-9 PFAM
Pfam:Methyltransf_18 111 215 9.9e-8 PFAM
Pfam:Methyltransf_11 116 215 6.2e-8 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit abnormal Purkinje cell dendrite morphology, hyperactivity, limb grasping and gait abnormalities, and show reduced levels of acetylcholine and choline along with increased phosphatidylcholine levels in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,343,737 D1501G probably damaging Het
Aldh8a1 A T 10: 21,395,430 I352F probably damaging Het
Bend7 G A 2: 4,744,332 E87K probably damaging Het
Bend7 A G 2: 4,752,899 R251G probably benign Het
Cep72 A T 13: 74,049,031 S402T probably benign Het
Cer1 A G 4: 82,882,883 V181A probably damaging Het
Ces1b T C 8: 93,073,262 N162S probably benign Het
Cyp1a2 T C 9: 57,681,053 N296S probably benign Het
Dst C T 1: 34,179,234 A1585V probably benign Het
Dzip1 G A 14: 118,909,480 P339L probably benign Het
Eif4enif1 T C 11: 3,242,401 I568T probably benign Het
Eif5a C T 11: 69,917,673 R109Q possibly damaging Het
Fam49a A G 12: 12,358,165 D64G probably benign Het
Foxj2 G A 6: 122,833,736 S225N probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Galnt14 T C 17: 73,574,882 Y74C probably damaging Het
Glrb T A 3: 80,861,979 N147I probably damaging Het
Grb14 A T 2: 64,917,284 M377K probably damaging Het
Kcng1 C T 2: 168,268,723 E174K possibly damaging Het
Kdm3b A C 18: 34,828,469 E1433A probably damaging Het
Matn3 G A 12: 8,970,571 R481H probably damaging Het
Mcm6 A G 1: 128,348,455 V331A probably benign Het
Mdga2 T C 12: 66,655,182 Y415C probably damaging Het
Med11 T C 11: 70,452,285 S65P probably damaging Het
Metrnl T A 11: 121,708,112 S166T probably benign Het
Mllt6 A G 11: 97,672,574 K328E probably damaging Het
Nek5 T C 8: 22,096,736 K353R probably benign Het
Olfr599 A G 7: 103,338,995 T314A probably benign Het
Olfr965 T A 9: 39,719,230 M1K probably null Het
Pfkl A T 10: 78,002,022 N46K possibly damaging Het
Phactr3 A G 2: 178,302,793 E428G probably damaging Het
Pkhd1 T C 1: 20,058,678 S3934G probably benign Het
Pkhd1l1 A G 15: 44,566,322 D3312G probably benign Het
Psd3 A T 8: 67,960,510 V742E possibly damaging Het
S100a14 A G 3: 90,527,850 H56R probably damaging Het
Scaf8 T A 17: 3,177,713 S406T unknown Het
Slc26a4 G T 12: 31,528,685 H656Q probably damaging Het
Smarcc1 T C 9: 110,197,644 V724A possibly damaging Het
Thbs2 C T 17: 14,684,071 probably null Het
Zbtb6 A T 2: 37,429,215 F234I probably benign Het
Zfp536 C T 7: 37,480,628 D851N probably damaging Het
Other mutations in Prmt8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Prmt8 APN 6 127690717 missense probably benign 0.17
IGL02178:Prmt8 APN 6 127697807 missense probably benign 0.06
IGL02526:Prmt8 APN 6 127711823 missense probably damaging 0.96
IGL03010:Prmt8 APN 6 127729535 missense probably benign 0.09
IGL03037:Prmt8 APN 6 127703977 missense possibly damaging 0.75
R0096:Prmt8 UTSW 6 127732627 splice site probably benign
R0254:Prmt8 UTSW 6 127711808 missense probably damaging 1.00
R0355:Prmt8 UTSW 6 127711874 nonsense probably null
R0925:Prmt8 UTSW 6 127697813 missense probably benign 0.00
R1606:Prmt8 UTSW 6 127689836 nonsense probably null
R1716:Prmt8 UTSW 6 127726523 critical splice donor site probably null
R3789:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3790:Prmt8 UTSW 6 127711147 missense probably damaging 1.00
R3958:Prmt8 UTSW 6 127732744 missense probably benign 0.00
R5022:Prmt8 UTSW 6 127711163 missense possibly damaging 0.92
R5143:Prmt8 UTSW 6 127732714 missense probably benign
R5635:Prmt8 UTSW 6 127768729 missense probably damaging 1.00
R5959:Prmt8 UTSW 6 127729418 missense probably damaging 1.00
R6267:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6296:Prmt8 UTSW 6 127711804 missense probably damaging 0.99
R6450:Prmt8 UTSW 6 127732643 missense possibly damaging 0.71
R6603:Prmt8 UTSW 6 127729413 missense probably benign 0.00
R7208:Prmt8 UTSW 6 127689829 missense possibly damaging 0.81
R7629:Prmt8 UTSW 6 127689883 nonsense probably null
R7719:Prmt8 UTSW 6 127729503 missense probably damaging 0.97
R8313:Prmt8 UTSW 6 127689850 missense probably benign
R8346:Prmt8 UTSW 6 127711847 missense probably damaging 1.00
R8404:Prmt8 UTSW 6 127689862 missense possibly damaging 0.93
R8483:Prmt8 UTSW 6 127704013 splice site probably null
R8843:Prmt8 UTSW 6 127729499 missense probably damaging 0.99
X0020:Prmt8 UTSW 6 127697771 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGAGGTAATTGGTCTCAGACTC -3'
(R):5'- TCACCCCAAAGTAGTGGCTAATC -3'

Sequencing Primer
(F):5'- GAGGTAATTGGTCTCAGACTCTATTC -3'
(R):5'- AGTGGCTAATCAAGTTTTTCTAGGG -3'
Posted On2016-12-20