Incidental Mutation 'R5816:Nek5'
ID449044
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission 043214-MU
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5816 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22096736 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 353 (K353R)
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably benign
Transcript: ENSMUST00000169834
AA Change: K353R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738
AA Change: K353R

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209656
AA Change: K353R

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213644
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,343,737 D1501G probably damaging Het
Aldh8a1 A T 10: 21,395,430 I352F probably damaging Het
Bend7 G A 2: 4,744,332 E87K probably damaging Het
Bend7 A G 2: 4,752,899 R251G probably benign Het
Cep72 A T 13: 74,049,031 S402T probably benign Het
Cer1 A G 4: 82,882,883 V181A probably damaging Het
Ces1b T C 8: 93,073,262 N162S probably benign Het
Cyp1a2 T C 9: 57,681,053 N296S probably benign Het
Dst C T 1: 34,179,234 A1585V probably benign Het
Dzip1 G A 14: 118,909,480 P339L probably benign Het
Eif4enif1 T C 11: 3,242,401 I568T probably benign Het
Eif5a C T 11: 69,917,673 R109Q possibly damaging Het
Fam49a A G 12: 12,358,165 D64G probably benign Het
Foxj2 G A 6: 122,833,736 S225N probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Galnt14 T C 17: 73,574,882 Y74C probably damaging Het
Glrb T A 3: 80,861,979 N147I probably damaging Het
Grb14 A T 2: 64,917,284 M377K probably damaging Het
Kcng1 C T 2: 168,268,723 E174K possibly damaging Het
Kdm3b A C 18: 34,828,469 E1433A probably damaging Het
Matn3 G A 12: 8,970,571 R481H probably damaging Het
Mcm6 A G 1: 128,348,455 V331A probably benign Het
Mdga2 T C 12: 66,655,182 Y415C probably damaging Het
Med11 T C 11: 70,452,285 S65P probably damaging Het
Metrnl T A 11: 121,708,112 S166T probably benign Het
Mllt6 A G 11: 97,672,574 K328E probably damaging Het
Olfr599 A G 7: 103,338,995 T314A probably benign Het
Olfr965 T A 9: 39,719,230 M1K probably null Het
Pfkl A T 10: 78,002,022 N46K possibly damaging Het
Phactr3 A G 2: 178,302,793 E428G probably damaging Het
Pkhd1 T C 1: 20,058,678 S3934G probably benign Het
Pkhd1l1 A G 15: 44,566,322 D3312G probably benign Het
Prmt8 G A 6: 127,697,738 T309I probably benign Het
Psd3 A T 8: 67,960,510 V742E possibly damaging Het
S100a14 A G 3: 90,527,850 H56R probably damaging Het
Scaf8 T A 17: 3,177,713 S406T unknown Het
Slc26a4 G T 12: 31,528,685 H656Q probably damaging Het
Smarcc1 T C 9: 110,197,644 V724A possibly damaging Het
Thbs2 C T 17: 14,684,071 probably null Het
Zbtb6 A T 2: 37,429,215 F234I probably benign Het
Zfp536 C T 7: 37,480,628 D851N probably damaging Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACATTGGTTCTCCCTGTCAG -3'
(R):5'- AGTAAATAGTCCGGGTTAAGGC -3'

Sequencing Primer
(F):5'- TCCCTGTCAGCCTCCAAAC -3'
(R):5'- TCCGGGTTAAGGCAGAATATG -3'
Posted On2016-12-20