Incidental Mutation 'R5816:Ces1b'
ID449046
Institutional Source Beutler Lab
Gene Symbol Ces1b
Ensembl Gene ENSMUSG00000078964
Gene Namecarboxylesterase 1B
SynonymsGm5158
MMRRC Submission 043214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5816 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93056728-93080017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93073262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 162 (N162S)
Ref Sequence ENSEMBL: ENSMUSP00000105210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109582]
Predicted Effect probably benign
Transcript: ENSMUST00000109582
AA Change: N162S

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105210
Gene: ENSMUSG00000078964
AA Change: N162S

DomainStartEndE-ValueType
Pfam:COesterase 1 547 7.6e-168 PFAM
Pfam:Abhydrolase_3 136 245 8.5e-11 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,343,737 D1501G probably damaging Het
Aldh8a1 A T 10: 21,395,430 I352F probably damaging Het
Bend7 G A 2: 4,744,332 E87K probably damaging Het
Bend7 A G 2: 4,752,899 R251G probably benign Het
Cep72 A T 13: 74,049,031 S402T probably benign Het
Cer1 A G 4: 82,882,883 V181A probably damaging Het
Cyp1a2 T C 9: 57,681,053 N296S probably benign Het
Dst C T 1: 34,179,234 A1585V probably benign Het
Dzip1 G A 14: 118,909,480 P339L probably benign Het
Eif4enif1 T C 11: 3,242,401 I568T probably benign Het
Eif5a C T 11: 69,917,673 R109Q possibly damaging Het
Fam49a A G 12: 12,358,165 D64G probably benign Het
Foxj2 G A 6: 122,833,736 S225N probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Galnt14 T C 17: 73,574,882 Y74C probably damaging Het
Glrb T A 3: 80,861,979 N147I probably damaging Het
Grb14 A T 2: 64,917,284 M377K probably damaging Het
Kcng1 C T 2: 168,268,723 E174K possibly damaging Het
Kdm3b A C 18: 34,828,469 E1433A probably damaging Het
Matn3 G A 12: 8,970,571 R481H probably damaging Het
Mcm6 A G 1: 128,348,455 V331A probably benign Het
Mdga2 T C 12: 66,655,182 Y415C probably damaging Het
Med11 T C 11: 70,452,285 S65P probably damaging Het
Metrnl T A 11: 121,708,112 S166T probably benign Het
Mllt6 A G 11: 97,672,574 K328E probably damaging Het
Nek5 T C 8: 22,096,736 K353R probably benign Het
Olfr599 A G 7: 103,338,995 T314A probably benign Het
Olfr965 T A 9: 39,719,230 M1K probably null Het
Pfkl A T 10: 78,002,022 N46K possibly damaging Het
Phactr3 A G 2: 178,302,793 E428G probably damaging Het
Pkhd1 T C 1: 20,058,678 S3934G probably benign Het
Pkhd1l1 A G 15: 44,566,322 D3312G probably benign Het
Prmt8 G A 6: 127,697,738 T309I probably benign Het
Psd3 A T 8: 67,960,510 V742E possibly damaging Het
S100a14 A G 3: 90,527,850 H56R probably damaging Het
Scaf8 T A 17: 3,177,713 S406T unknown Het
Slc26a4 G T 12: 31,528,685 H656Q probably damaging Het
Smarcc1 T C 9: 110,197,644 V724A possibly damaging Het
Thbs2 C T 17: 14,684,071 probably null Het
Zbtb6 A T 2: 37,429,215 F234I probably benign Het
Zfp536 C T 7: 37,480,628 D851N probably damaging Het
Other mutations in Ces1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01406:Ces1b APN 8 93071994 missense probably damaging 0.98
IGL01939:Ces1b APN 8 93079431 missense probably damaging 1.00
IGL02314:Ces1b APN 8 93064896 missense possibly damaging 0.95
IGL02338:Ces1b APN 8 93057047 missense possibly damaging 0.77
IGL02647:Ces1b APN 8 93057044 missense probably benign 0.00
IGL02833:Ces1b APN 8 93079410 missense probably damaging 1.00
IGL03038:Ces1b APN 8 93067052 missense probably benign
IGL03149:Ces1b APN 8 93064874 splice site probably benign
FR4548:Ces1b UTSW 8 93068092 missense probably null
IGL02802:Ces1b UTSW 8 93056966 missense possibly damaging 0.64
R0382:Ces1b UTSW 8 93076052 splice site probably benign
R0893:Ces1b UTSW 8 93079428 missense probably benign 0.11
R0959:Ces1b UTSW 8 93068147 missense probably damaging 1.00
R1386:Ces1b UTSW 8 93068077 missense probably benign 0.02
R1440:Ces1b UTSW 8 93068108 missense probably damaging 0.97
R1667:Ces1b UTSW 8 93056904 missense possibly damaging 0.75
R2113:Ces1b UTSW 8 93068155 missense probably benign
R2193:Ces1b UTSW 8 93079877 missense probably benign 0.00
R2508:Ces1b UTSW 8 93073341 missense possibly damaging 0.75
R4656:Ces1b UTSW 8 93057414 missense probably damaging 0.96
R4776:Ces1b UTSW 8 93063030 missense possibly damaging 0.92
R5108:Ces1b UTSW 8 93071913 missense probably damaging 1.00
R5117:Ces1b UTSW 8 93073209 critical splice donor site probably null
R5308:Ces1b UTSW 8 93067017 missense probably benign 0.00
R5381:Ces1b UTSW 8 93065019 missense probably benign 0.02
R5392:Ces1b UTSW 8 93071962 missense probably damaging 0.98
R5614:Ces1b UTSW 8 93068208 missense probably benign 0.00
R6554:Ces1b UTSW 8 93064991 missense probably benign 0.03
R6576:Ces1b UTSW 8 93056919 missense probably benign 0.06
R6601:Ces1b UTSW 8 93079481 missense probably benign
R6662:Ces1b UTSW 8 93064069 missense probably benign 0.33
R6753:Ces1b UTSW 8 93067020 nonsense probably null
R6904:Ces1b UTSW 8 93060410 missense probably damaging 0.96
R7267:Ces1b UTSW 8 93079504 missense possibly damaging 0.58
R7371:Ces1b UTSW 8 93057354 critical splice donor site probably null
R7396:Ces1b UTSW 8 93063129 missense probably benign 0.00
X0024:Ces1b UTSW 8 93063017 missense probably benign
Z1088:Ces1b UTSW 8 93064966 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAACCTTTCAATCAACCTCTGGTC -3'
(R):5'- GAGTCAGCCTTTTGCAACCTTC -3'

Sequencing Primer
(F):5'- AACCTCTGGTCTTATATCTAGACAC -3'
(R):5'- TGGTTTGATCAATGACCTCCAG -3'
Posted On2016-12-20