Incidental Mutation 'R5816:Cep72'
ID449065
Institutional Source Beutler Lab
Gene Symbol Cep72
Ensembl Gene ENSMUSG00000021572
Gene Namecentrosomal protein 72
Synonyms
MMRRC Submission 043214-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5816 (G1)
Quality Score135
Status Not validated
Chromosome13
Chromosomal Location74036500-74062299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74049031 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 402 (S402T)
Ref Sequence ENSEMBL: ENSMUSP00000037788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036456] [ENSMUST00000221122] [ENSMUST00000222609]
Predicted Effect probably benign
Transcript: ENSMUST00000036456
AA Change: S402T

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037788
Gene: ENSMUSG00000021572
AA Change: S402T

DomainStartEndE-ValueType
LRR 52 73 2.92e1 SMART
LRR 74 96 5.34e-1 SMART
LRRcap 116 134 1.89e-4 SMART
low complexity region 307 319 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
coiled coil region 485 531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221122
AA Change: S51T

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000222609
AA Change: S315T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000223028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223031
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223417
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the leucine-rich-repeat (LRR) superfamily of proteins. The protein is localized to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 T C 11: 94,343,737 D1501G probably damaging Het
Aldh8a1 A T 10: 21,395,430 I352F probably damaging Het
Bend7 G A 2: 4,744,332 E87K probably damaging Het
Bend7 A G 2: 4,752,899 R251G probably benign Het
Cer1 A G 4: 82,882,883 V181A probably damaging Het
Ces1b T C 8: 93,073,262 N162S probably benign Het
Cyp1a2 T C 9: 57,681,053 N296S probably benign Het
Dst C T 1: 34,179,234 A1585V probably benign Het
Dzip1 G A 14: 118,909,480 P339L probably benign Het
Eif4enif1 T C 11: 3,242,401 I568T probably benign Het
Eif5a C T 11: 69,917,673 R109Q possibly damaging Het
Fam49a A G 12: 12,358,165 D64G probably benign Het
Foxj2 G A 6: 122,833,736 S225N probably benign Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Galnt14 T C 17: 73,574,882 Y74C probably damaging Het
Glrb T A 3: 80,861,979 N147I probably damaging Het
Grb14 A T 2: 64,917,284 M377K probably damaging Het
Kcng1 C T 2: 168,268,723 E174K possibly damaging Het
Kdm3b A C 18: 34,828,469 E1433A probably damaging Het
Matn3 G A 12: 8,970,571 R481H probably damaging Het
Mcm6 A G 1: 128,348,455 V331A probably benign Het
Mdga2 T C 12: 66,655,182 Y415C probably damaging Het
Med11 T C 11: 70,452,285 S65P probably damaging Het
Metrnl T A 11: 121,708,112 S166T probably benign Het
Mllt6 A G 11: 97,672,574 K328E probably damaging Het
Nek5 T C 8: 22,096,736 K353R probably benign Het
Olfr599 A G 7: 103,338,995 T314A probably benign Het
Olfr965 T A 9: 39,719,230 M1K probably null Het
Pfkl A T 10: 78,002,022 N46K possibly damaging Het
Phactr3 A G 2: 178,302,793 E428G probably damaging Het
Pkhd1 T C 1: 20,058,678 S3934G probably benign Het
Pkhd1l1 A G 15: 44,566,322 D3312G probably benign Het
Prmt8 G A 6: 127,697,738 T309I probably benign Het
Psd3 A T 8: 67,960,510 V742E possibly damaging Het
S100a14 A G 3: 90,527,850 H56R probably damaging Het
Scaf8 T A 17: 3,177,713 S406T unknown Het
Slc26a4 G T 12: 31,528,685 H656Q probably damaging Het
Smarcc1 T C 9: 110,197,644 V724A possibly damaging Het
Thbs2 C T 17: 14,684,071 probably null Het
Zbtb6 A T 2: 37,429,215 F234I probably benign Het
Zfp536 C T 7: 37,480,628 D851N probably damaging Het
Other mutations in Cep72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Cep72 APN 13 74062268 unclassified probably benign
IGL01373:Cep72 APN 13 74059459 missense probably damaging 1.00
IGL02415:Cep72 APN 13 74050154 missense probably benign 0.31
IGL03372:Cep72 APN 13 74043518 missense possibly damaging 0.47
R0608:Cep72 UTSW 13 74038304 missense probably damaging 1.00
R0884:Cep72 UTSW 13 74054881 critical splice donor site probably null
R2400:Cep72 UTSW 13 74048977 missense probably damaging 0.99
R4906:Cep72 UTSW 13 74059465 missense probably damaging 1.00
R5534:Cep72 UTSW 13 74062216 missense probably benign 0.05
R5567:Cep72 UTSW 13 74040141 missense probably benign 0.00
R5570:Cep72 UTSW 13 74040141 missense probably benign 0.00
R6310:Cep72 UTSW 13 74053025 missense possibly damaging 0.94
R6513:Cep72 UTSW 13 74058463 missense probably damaging 1.00
R6848:Cep72 UTSW 13 74038276 missense possibly damaging 0.85
R6936:Cep72 UTSW 13 74040087 missense probably damaging 1.00
R7000:Cep72 UTSW 13 74058325 missense probably damaging 0.96
R7006:Cep72 UTSW 13 74050308 nonsense probably null
R7074:Cep72 UTSW 13 74051580 missense probably benign 0.16
R7640:Cep72 UTSW 13 74058488 nonsense probably null
R7889:Cep72 UTSW 13 74050122 missense possibly damaging 0.84
R8260:Cep72 UTSW 13 74058346 missense probably damaging 1.00
R8751:Cep72 UTSW 13 74050184 missense possibly damaging 0.60
R8789:Cep72 UTSW 13 74038248 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- ACCCCAGGTTGGATGAACAC -3'
(R):5'- TATTAGAGCCTCATAGAAAGCCAGC -3'

Sequencing Primer
(F):5'- CCTAGCAGGTGAGCAGCATCTC -3'
(R):5'- CAGCTTCACAGATGGGTGTCTC -3'
Posted On2016-12-20