Mutagenetix > Incidental Mutations

Incidental Mutation 'R5817:Pomt1'

449073

Institutional Source

Beutler Lab

Gene Symbol

Pomt1

Ensembl Gene

ENSMUSG00000039254

Gene Name

protein-O-mannosyltransferase 1

Synonyms

MMRRC Submission

043397-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R5817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32236590-32255005 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32248679 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 436 (I436F)

Ref Sequence

ENSEMBL: ENSMUSP00000038722 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036473] [ENSMUST00000123740]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036473
AA Change: I436F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254
AA Change: I436F

Domain	Start	End	E-Value	Type
Pfam:PMT	42	289	2.8e-96	PFAM
MIR	318	381	7.45e-8	SMART
MIR	392	449	1.65e-9	SMART
MIR	456	513	6.2e-5	SMART
Pfam:PMT_4TMC	542	740	3.9e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123740

SMART Domains

Protein: ENSMUSP00000116543
Gene: ENSMUSG00000039254

Domain	Start	End	E-Value	Type
Pfam:PMT	20	233	1.3e-84	PFAM
Pfam:PMT_2	64	229	3.2e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129163

Predicted Effect

probably benign
Transcript: ENSMUST00000132516

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132853

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151598

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154684

Predicted Effect

unknown
Transcript: ENSMUST00000192998
AA Change: I6F

Meta Mutation Damage Score

0.6898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Ahnak2	A	T	12: 112,774,003	F406I	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
D630003M21Rik	A	G	2: 158,196,493	L1011P	probably damaging	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Map1a	A	T	2: 121,298,910	H143L	possibly damaging	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Pole	G	A	5: 110,312,972	D1176N	probably damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Prag1	A	C	8: 36,103,703	Q480P	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het
Zc3h13	A	G	14: 75,328,132	E895G	probably damaging	Het

Other mutations in Pomt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Pomt1	APN	2	32241772	missense	probably benign
IGL01926:Pomt1	APN	2	32243472	missense	probably benign	0.23
IGL02237:Pomt1	APN	2	32245677	missense	probably benign	0.18
IGL02281:Pomt1	APN	2	32248646	missense	possibly damaging	0.95
IGL03001:Pomt1	APN	2	32244326	missense	probably benign
IGL03216:Pomt1	APN	2	32242943	missense	probably damaging	0.99
IGL03343:Pomt1	APN	2	32253712	splice site	probably benign
R0049:Pomt1	UTSW	2	32252011	missense	possibly damaging	0.88
R0049:Pomt1	UTSW	2	32252011	missense	possibly damaging	0.88
R0975:Pomt1	UTSW	2	32253895	critical splice donor site	probably null
R1199:Pomt1	UTSW	2	32250492	missense	probably benign
R1414:Pomt1	UTSW	2	32243610	splice site	probably benign
R1421:Pomt1	UTSW	2	32236753	unclassified	probably benign
R1806:Pomt1	UTSW	2	32241668	missense	probably damaging	1.00
R2173:Pomt1	UTSW	2	32250900	missense	probably damaging	1.00
R2209:Pomt1	UTSW	2	32250862	missense	possibly damaging	0.90
R2302:Pomt1	UTSW	2	32243659	missense	probably benign	0.00
R3084:Pomt1	UTSW	2	32244240	missense	probably benign	0.02
R3774:Pomt1	UTSW	2	32244250	missense	possibly damaging	0.93
R3933:Pomt1	UTSW	2	32245619	missense	probably benign	0.00
R4177:Pomt1	UTSW	2	32248677	missense	probably damaging	0.99
R4626:Pomt1	UTSW	2	32254412	missense	possibly damaging	0.84
R4645:Pomt1	UTSW	2	32242876	intron	probably benign
R4864:Pomt1	UTSW	2	32251992	missense	probably benign	0.02
R4911:Pomt1	UTSW	2	32241679	missense	probably damaging	0.97
R5143:Pomt1	UTSW	2	32254329	missense	probably benign	0.23
R5288:Pomt1	UTSW	2	32244299	nonsense	probably null
R5385:Pomt1	UTSW	2	32244299	nonsense	probably null
R5718:Pomt1	UTSW	2	32248692	missense	possibly damaging	0.91
R5735:Pomt1	UTSW	2	32243505	missense	probably damaging	1.00
R5754:Pomt1	UTSW	2	32247590	missense	probably damaging	0.99
R6304:Pomt1	UTSW	2	32250790	missense	probably damaging	1.00
R6477:Pomt1	UTSW	2	32248716	splice site	probably null
R6793:Pomt1	UTSW	2	32242949	missense	probably damaging	1.00
R6918:Pomt1	UTSW	2	32252861	splice site	probably null
R7114:Pomt1	UTSW	2	32253836	missense	probably benign	0.41
R8140:Pomt1	UTSW	2	32244297	missense	probably damaging	1.00
R8380:Pomt1	UTSW	2	32245607	missense	probably damaging	1.00
Z1177:Pomt1	UTSW	2	32237089	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- TTTGTGGCCAGCTTCCCTAG -3'
(R):5'- TTTCCCAATCCATGCCTGAGG -3'

Sequencing Primer
(F):5'- TTCCCTAGCCTTGGCAGG -3'
(R):5'- ATTGGGACATCTCAGACTTGC -3'

Posted On

2016-12-20