Incidental Mutation 'R5817:Pomt1'
ID449073
Institutional Source Beutler Lab
Gene Symbol Pomt1
Ensembl Gene ENSMUSG00000039254
Gene Nameprotein-O-mannosyltransferase 1
Synonyms
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32236590-32255005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32248679 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 436 (I436F)
Ref Sequence ENSEMBL: ENSMUSP00000038722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036473] [ENSMUST00000123740]
Predicted Effect probably damaging
Transcript: ENSMUST00000036473
AA Change: I436F

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254
AA Change: I436F

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123740
SMART Domains Protein: ENSMUSP00000116543
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 20 233 1.3e-84 PFAM
Pfam:PMT_2 64 229 3.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129163
Predicted Effect probably benign
Transcript: ENSMUST00000132516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154684
Predicted Effect unknown
Transcript: ENSMUST00000192998
AA Change: I6F
Meta Mutation Damage Score 0.6898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Il6 A G 5: 30,018,008 I91V probably benign Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Pomt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pomt1 APN 2 32241772 missense probably benign
IGL01926:Pomt1 APN 2 32243472 missense probably benign 0.23
IGL02237:Pomt1 APN 2 32245677 missense probably benign 0.18
IGL02281:Pomt1 APN 2 32248646 missense possibly damaging 0.95
IGL03001:Pomt1 APN 2 32244326 missense probably benign
IGL03216:Pomt1 APN 2 32242943 missense probably damaging 0.99
IGL03343:Pomt1 APN 2 32253712 splice site probably benign
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0975:Pomt1 UTSW 2 32253895 critical splice donor site probably null
R1199:Pomt1 UTSW 2 32250492 missense probably benign
R1414:Pomt1 UTSW 2 32243610 splice site probably benign
R1421:Pomt1 UTSW 2 32236753 unclassified probably benign
R1806:Pomt1 UTSW 2 32241668 missense probably damaging 1.00
R2173:Pomt1 UTSW 2 32250900 missense probably damaging 1.00
R2209:Pomt1 UTSW 2 32250862 missense possibly damaging 0.90
R2302:Pomt1 UTSW 2 32243659 missense probably benign 0.00
R3084:Pomt1 UTSW 2 32244240 missense probably benign 0.02
R3774:Pomt1 UTSW 2 32244250 missense possibly damaging 0.93
R3933:Pomt1 UTSW 2 32245619 missense probably benign 0.00
R4177:Pomt1 UTSW 2 32248677 missense probably damaging 0.99
R4626:Pomt1 UTSW 2 32254412 missense possibly damaging 0.84
R4645:Pomt1 UTSW 2 32242876 intron probably benign
R4864:Pomt1 UTSW 2 32251992 missense probably benign 0.02
R4911:Pomt1 UTSW 2 32241679 missense probably damaging 0.97
R5143:Pomt1 UTSW 2 32254329 missense probably benign 0.23
R5288:Pomt1 UTSW 2 32244299 nonsense probably null
R5385:Pomt1 UTSW 2 32244299 nonsense probably null
R5718:Pomt1 UTSW 2 32248692 missense possibly damaging 0.91
R5735:Pomt1 UTSW 2 32243505 missense probably damaging 1.00
R5754:Pomt1 UTSW 2 32247590 missense probably damaging 0.99
R6304:Pomt1 UTSW 2 32250790 missense probably damaging 1.00
R6477:Pomt1 UTSW 2 32248716 splice site probably null
R6793:Pomt1 UTSW 2 32242949 missense probably damaging 1.00
R6918:Pomt1 UTSW 2 32252861 splice site probably null
R7114:Pomt1 UTSW 2 32253836 missense probably benign 0.41
R8140:Pomt1 UTSW 2 32244297 missense probably damaging 1.00
R8380:Pomt1 UTSW 2 32245607 missense probably damaging 1.00
Z1177:Pomt1 UTSW 2 32237089 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTGTGGCCAGCTTCCCTAG -3'
(R):5'- TTTCCCAATCCATGCCTGAGG -3'

Sequencing Primer
(F):5'- TTCCCTAGCCTTGGCAGG -3'
(R):5'- ATTGGGACATCTCAGACTTGC -3'
Posted On2016-12-20