Mutagenetix > Incidental Mutation

Incidental Mutation 'R5817:D630003M21Rik'

449079

Institutional Source

Beutler Lab

Gene Symbol

D630003M21Rik

Ensembl Gene

ENSMUSG00000037813

Gene Name

RIKEN cDNA D630003M21 gene

Synonyms

MMRRC Submission

043397-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.059) question?

Stock #

R5817 (G1)

Quality Score

155

Status

Validated

Chromosome

Chromosomal Location

158182533-158229222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 158196493 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1011 (L1011P)

Ref Sequence

ENSEMBL: ENSMUSP00000130623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046944] [ENSMUST00000103121] [ENSMUST00000169335]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046944
AA Change: L1011P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000040546
Gene: ENSMUSG00000037813
AA Change: L1011P

Domain	Start	End	E-Value	Type
low complexity region	321	333	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	517	535	N/A	INTRINSIC
Blast:SEC14	567	702	1e-6	BLAST
SCOP:d1aua_2	567	711	5e-9	SMART
Blast:SPEC	712	824	3e-16	BLAST
low complexity region	826	839	N/A	INTRINSIC
low complexity region	903	911	N/A	INTRINSIC
low complexity region	918	929	N/A	INTRINSIC
low complexity region	1160	1174	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103121
AA Change: L1011P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: L1011P

Domain	Start	End	E-Value	Type
low complexity region	321	333	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	517	535	N/A	INTRINSIC
Blast:SEC14	567	702	7e-7	BLAST
SCOP:d1aua_2	567	711	4e-9	SMART
Blast:SPEC	712	824	3e-16	BLAST
low complexity region	826	839	N/A	INTRINSIC
low complexity region	903	911	N/A	INTRINSIC
low complexity region	918	929	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000109506

Predicted Effect

probably damaging
Transcript: ENSMUST00000169335
AA Change: L1011P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: L1011P

Domain	Start	End	E-Value	Type
low complexity region	321	333	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	517	535	N/A	INTRINSIC
Blast:SEC14	567	702	7e-7	BLAST
SCOP:d1aua_2	567	711	4e-9	SMART
Blast:SPEC	712	824	3e-16	BLAST
low complexity region	826	839	N/A	INTRINSIC
low complexity region	903	911	N/A	INTRINSIC
low complexity region	918	929	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Meta Mutation Damage Score

0.4695

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Ahnak2	A	T	12: 112,774,003	F406I	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Map1a	A	T	2: 121,298,910	H143L	possibly damaging	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Pole	G	A	5: 110,312,972	D1176N	probably damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Pomt1	A	T	2: 32,248,679	I436F	probably damaging	Het
Prag1	A	C	8: 36,103,703	Q480P	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het
Zc3h13	A	G	14: 75,328,132	E895G	probably damaging	Het

Other mutations in D630003M21Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:D630003M21Rik	APN	2	158213412	missense	possibly damaging	0.92
IGL01447:D630003M21Rik	APN	2	158217356	missense	probably benign
IGL01501:D630003M21Rik	APN	2	158201067	missense	probably benign	0.03
IGL01874:D630003M21Rik	APN	2	158204724	missense	probably damaging	1.00
IGL02116:D630003M21Rik	APN	2	158203210	missense	possibly damaging	0.76
IGL02212:D630003M21Rik	APN	2	158210171	missense	probably benign	0.02
IGL02477:D630003M21Rik	APN	2	158217488	missense	probably benign	0.44
IGL02644:D630003M21Rik	APN	2	158216810	missense	possibly damaging	0.87
IGL02861:D630003M21Rik	APN	2	158200998	missense	probably benign	0.03
IGL02896:D630003M21Rik	APN	2	158217285	missense	probably benign	0.00
IGL03089:D630003M21Rik	APN	2	158216744	missense	probably benign
IGL03148:D630003M21Rik	APN	2	158217224	missense	probably damaging	1.00
ANU05:D630003M21Rik	UTSW	2	158196388	missense	probably benign	0.00
ANU18:D630003M21Rik	UTSW	2	158217648	missense	probably benign
F5770:D630003M21Rik	UTSW	2	158201011	missense	probably benign	0.38
R0113:D630003M21Rik	UTSW	2	158196575	missense	possibly damaging	0.92
R0147:D630003M21Rik	UTSW	2	158203067	splice site	probably benign
R0513:D630003M21Rik	UTSW	2	158200308	missense	probably benign	0.44
R0637:D630003M21Rik	UTSW	2	158195407	intron	probably benign
R1594:D630003M21Rik	UTSW	2	158211630	missense	probably damaging	1.00
R1774:D630003M21Rik	UTSW	2	158220470	missense	probably damaging	1.00
R1823:D630003M21Rik	UTSW	2	158217557	missense	probably damaging	1.00
R1864:D630003M21Rik	UTSW	2	158203185	missense	probably damaging	1.00
R1983:D630003M21Rik	UTSW	2	158208421	missense	probably benign	0.34
R2042:D630003M21Rik	UTSW	2	158215849	missense	probably damaging	1.00
R2259:D630003M21Rik	UTSW	2	158204711	missense	probably damaging	1.00
R2350:D630003M21Rik	UTSW	2	158201011	missense	probably damaging	0.96
R3157:D630003M21Rik	UTSW	2	158195472	intron	probably benign
R3937:D630003M21Rik	UTSW	2	158200360	missense	probably damaging	1.00
R4124:D630003M21Rik	UTSW	2	158196593	missense	probably damaging	0.97
R4437:D630003M21Rik	UTSW	2	158213462	missense	probably damaging	1.00
R4473:D630003M21Rik	UTSW	2	158213462	missense	probably damaging	1.00
R4513:D630003M21Rik	UTSW	2	158204802	missense	probably benign	0.01
R4514:D630003M21Rik	UTSW	2	158204802	missense	probably benign	0.01
R4729:D630003M21Rik	UTSW	2	158216703	missense	probably damaging	1.00
R4794:D630003M21Rik	UTSW	2	158196139	missense	probably benign
R4947:D630003M21Rik	UTSW	2	158186196	missense	unknown
R5005:D630003M21Rik	UTSW	2	158211643	missense	possibly damaging	0.87
R5022:D630003M21Rik	UTSW	2	158217633	missense	probably damaging	0.99
R5167:D630003M21Rik	UTSW	2	158205745	missense	probably damaging	1.00
R5191:D630003M21Rik	UTSW	2	158201035	missense	probably benign	0.06
R5488:D630003M21Rik	UTSW	2	158217021	missense	probably benign	0.15
R5489:D630003M21Rik	UTSW	2	158217021	missense	probably benign	0.15
R5495:D630003M21Rik	UTSW	2	158220511	missense	possibly damaging	0.69
R5708:D630003M21Rik	UTSW	2	158220392	splice site	probably null
R5770:D630003M21Rik	UTSW	2	158195580	intron	probably benign
R5789:D630003M21Rik	UTSW	2	158216814	missense	possibly damaging	0.63
R5898:D630003M21Rik	UTSW	2	158204657	splice site	probably null
R5969:D630003M21Rik	UTSW	2	158217708	missense	probably damaging	1.00
R6084:D630003M21Rik	UTSW	2	158217584	missense	probably damaging	0.99
R6111:D630003M21Rik	UTSW	2	158213448	missense	probably damaging	1.00
R6225:D630003M21Rik	UTSW	2	158217401	missense	probably benign	0.23
R6307:D630003M21Rik	UTSW	2	158215951	missense	probably benign	0.34
R6350:D630003M21Rik	UTSW	2	158220495	missense	probably damaging	1.00
R6548:D630003M21Rik	UTSW	2	158205699	critical splice donor site	probably null
R6583:D630003M21Rik	UTSW	2	158220516	missense	probably damaging	0.98
R6821:D630003M21Rik	UTSW	2	158204774	missense	probably damaging	1.00
R6963:D630003M21Rik	UTSW	2	158200308	missense	probably benign	0.44
R7021:D630003M21Rik	UTSW	2	158216750	missense	possibly damaging	0.59
R7210:D630003M21Rik	UTSW	2	158216012	critical splice acceptor site	probably null
R7345:D630003M21Rik	UTSW	2	158217209	missense	probably damaging	1.00
R7355:D630003M21Rik	UTSW	2	158200224	missense	probably damaging	1.00
R7514:D630003M21Rik	UTSW	2	158217353	missense	probably damaging	1.00
R7587:D630003M21Rik	UTSW	2	158196388	missense	probably benign	0.00
R7587:D630003M21Rik	UTSW	2	158201056	missense	probably damaging	1.00
R7713:D630003M21Rik	UTSW	2	158216778	nonsense	probably null
R7792:D630003M21Rik	UTSW	2	158210162	missense	possibly damaging	0.94
R7819:D630003M21Rik	UTSW	2	158216798	missense	probably damaging	0.97
R7832:D630003M21Rik	UTSW	2	158217668	missense	probably damaging	1.00
R8115:D630003M21Rik	UTSW	2	158216590	missense	probably benign	0.23
R8482:D630003M21Rik	UTSW	2	158216932	missense	probably benign	0.01
R8829:D630003M21Rik	UTSW	2	158216936	missense	probably damaging	0.98
R8928:D630003M21Rik	UTSW	2	158217527	missense	probably damaging	1.00
R9183:D630003M21Rik	UTSW	2	158217192	missense	probably benign	0.00
R9254:D630003M21Rik	UTSW	2	158200963	missense	probably damaging	1.00
R9661:D630003M21Rik	UTSW	2	158205753	missense	possibly damaging	0.72
V7580:D630003M21Rik	UTSW	2	158201011	missense	probably benign	0.38
V7581:D630003M21Rik	UTSW	2	158201011	missense	probably benign	0.38
V7583:D630003M21Rik	UTSW	2	158201011	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- ACTTCTCTAGGCAGACCCTG -3'
(R):5'- ACGCATCATCTTTCCGGAGC -3'

Sequencing Primer
(F):5'- TCTAGGCAGACCCTGACCCTTAG -3'
(R):5'- ATCTTTCCGGAGCCCCCAC -3'

Posted On

2016-12-20