Incidental Mutation 'R5817:Il6'
ID449086
Institutional Source Beutler Lab
Gene Symbol Il6
Ensembl Gene ENSMUSG00000025746
Gene Nameinterleukin 6
SynonymsIl-6
MMRRC Submission 043397-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R5817 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30013114-30019981 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30018008 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 91 (I91V)
Ref Sequence ENSEMBL: ENSMUSP00000143157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026845] [ENSMUST00000195978] [ENSMUST00000199183] [ENSMUST00000199765]
Predicted Effect probably benign
Transcript: ENSMUST00000026845
AA Change: I108V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026845
Gene: ENSMUSG00000025746
AA Change: I108V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 209 2.1e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195978
AA Change: I108V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143544
Gene: ENSMUSG00000025746
AA Change: I108V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 162 5.8e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199183
AA Change: I108V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143293
Gene: ENSMUSG00000025746
AA Change: I108V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IL6 55 175 3.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199765
AA Change: I91V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143157
Gene: ENSMUSG00000025746
AA Change: I91V

DomainStartEndE-ValueType
IL6 38 192 2.1e-98 SMART
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: This gene encodes a member of the interleukin family of cytokines that have important functions in immune response, hematopoiesis, inflammation and the acute phase response. The ectopic overexpression of the encoded protein in mice results in excessive plasma cells in circulation, leading to death. Mice lacking the encoded protein exhibit abnormalities in hepatic acute phase response, some immune mechanisms, bone resorption in response to estrogen, liver regeneration and wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mutants show impaired immune response to pathogens, decreased T cell numbers and resistance to plasma cell neoplasia. They are defective in wound healing and liver regeneration and show increased emotionality and high bone turnover rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A G 4: 144,622,927 I251M probably benign Het
Abcf3 T C 16: 20,549,083 V63A possibly damaging Het
Agpat4 C T 17: 12,215,210 probably benign Het
Ahcyl2 G A 6: 29,890,721 V292M probably damaging Het
Ahnak2 A T 12: 112,774,003 F406I probably damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Arhgef5 G A 6: 43,275,104 D930N probably benign Het
Casc4 T A 2: 121,906,044 S231T probably benign Het
Cc2d2a G A 5: 43,712,418 R887Q probably damaging Het
Ceacam18 A G 7: 43,641,841 T236A probably benign Het
Chst15 A T 7: 132,269,144 Y221N probably damaging Het
Chst15 G A 7: 132,269,147 L220F probably damaging Het
Cntn2 G A 1: 132,518,748 T784I probably benign Het
D630003M21Rik A G 2: 158,196,493 L1011P probably damaging Het
Dync2h1 T A 9: 6,996,905 D3894V probably damaging Het
E330017A01Rik T C 16: 58,636,793 I89V probably benign Het
Fam13b T C 18: 34,457,797 M443V possibly damaging Het
Fam20a T A 11: 109,673,418 Q503L possibly damaging Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm21319 G T 12: 87,773,431 D119E probably benign Het
Gm5454 T A 13: 103,356,632 noncoding transcript Het
Gm5581 A G 6: 131,167,169 noncoding transcript Het
Gm6619 A G 6: 131,486,437 I6V unknown Het
Gmcl1 A G 6: 86,714,248 M255T probably damaging Het
Gprc5c T A 11: 114,863,624 C42* probably null Het
Hmcn1 T A 1: 150,737,524 E1384V possibly damaging Het
Kmt2d A T 15: 98,862,363 S1005T unknown Het
Map1a A T 2: 121,298,910 H143L possibly damaging Het
Mical2 A T 7: 112,323,659 T624S probably benign Het
Msh3 A T 13: 92,286,000 N549K possibly damaging Het
Ncr1 T A 7: 4,340,895 I164N possibly damaging Het
Olfr1333 T G 4: 118,830,099 T115P probably damaging Het
Olfr554 A G 7: 102,640,378 N44S probably damaging Het
Olfr586 A T 7: 103,121,908 M292K possibly damaging Het
Olfr926 A G 9: 38,877,377 D67G probably damaging Het
Palmd T C 3: 116,918,623 I541M probably benign Het
Pcsk7 A T 9: 45,926,033 M552L probably benign Het
Plekhh2 A G 17: 84,571,726 E626G possibly damaging Het
Pole G A 5: 110,312,972 D1176N probably damaging Het
Polr2f T C 15: 79,151,669 I110T probably damaging Het
Pomt1 A T 2: 32,248,679 I436F probably damaging Het
Prag1 A C 8: 36,103,703 Q480P probably damaging Het
Qars C T 9: 108,510,242 probably benign Het
Ralgapa2 G A 2: 146,333,486 S1797L probably damaging Het
Rbm26 T C 14: 105,128,603 T832A probably damaging Het
Rnf169 A G 7: 99,925,769 S540P probably benign Het
Serpini1 T A 3: 75,613,324 M76K probably benign Het
Shq1 A G 6: 100,573,720 L419S probably damaging Het
Slc25a17 G A 15: 81,327,060 T225M probably damaging Het
Slc6a5 C A 7: 49,956,491 L716I probably benign Het
Smc1b A G 15: 85,067,783 V1149A probably damaging Het
Trappc1 A T 11: 69,324,234 Q26L possibly damaging Het
Trpm2 C A 10: 77,965,980 G84W probably damaging Het
Ttn G A 2: 76,742,666 T24215M probably damaging Het
Ubn2 C A 6: 38,479,153 T337K probably damaging Het
Ubr4 A G 4: 139,468,847 K1265E probably damaging Het
Vmn1r214 T G 13: 23,035,321 I328M probably damaging Het
Xcr1 C T 9: 123,855,857 C280Y possibly damaging Het
Zc3h13 A G 14: 75,328,132 E895G probably damaging Het
Other mutations in Il6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00976:Il6 APN 5 30014841 missense probably benign 0.06
IGL01085:Il6 APN 5 30013489 missense probably damaging 0.98
IGL01549:Il6 APN 5 30019471 missense probably benign 0.01
R1510:Il6 UTSW 5 30018062 missense probably damaging 0.96
R1721:Il6 UTSW 5 30013492 missense possibly damaging 0.90
R1774:Il6 UTSW 5 30019435 missense probably benign
R2018:Il6 UTSW 5 30014947 critical splice donor site probably null
R2153:Il6 UTSW 5 30013504 nonsense probably null
R2344:Il6 UTSW 5 30014856 missense probably benign 0.00
R3889:Il6 UTSW 5 30018068 missense possibly damaging 0.57
R4743:Il6 UTSW 5 30018044 missense probably damaging 0.96
R4769:Il6 UTSW 5 30018078 nonsense probably null
R4965:Il6 UTSW 5 30013493 missense possibly damaging 0.53
R5024:Il6 UTSW 5 30019514 missense probably damaging 1.00
R5858:Il6 UTSW 5 30013474 missense possibly damaging 0.67
R6886:Il6 UTSW 5 30018203 intron probably benign
R7254:Il6 UTSW 5 30014908 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GTTGCTGTATCAATACCATGCAG -3'
(R):5'- CCACACTGCATGAGAGATGG -3'

Sequencing Primer
(F):5'- CACAATTGCTCTGTAGTACAGC -3'
(R):5'- GGGAAGCACTCACCTCTTG -3'
Posted On2016-12-20