Mutagenetix > Incidental Mutations

Incidental Mutation 'R5817:Pole'

449089

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

MMRRC Submission

043397-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5817 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 110312972 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 1176 (D1176N)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296]

AlphaFold

Q9WVF7

Predicted Effect

probably damaging
Transcript: ENSMUST00000007296
AA Change: D1176N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: D1176N

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131887

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182442

Meta Mutation Damage Score

0.5851

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	A	G	4: 144,622,927	I251M	probably benign	Het
Abcf3	T	C	16: 20,549,083	V63A	possibly damaging	Het
Agpat4	C	T	17: 12,215,210		probably benign	Het
Ahcyl2	G	A	6: 29,890,721	V292M	probably damaging	Het
Ahnak2	A	T	12: 112,774,003	F406I	probably damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Arhgef5	G	A	6: 43,275,104	D930N	probably benign	Het
Casc4	T	A	2: 121,906,044	S231T	probably benign	Het
Cc2d2a	G	A	5: 43,712,418	R887Q	probably damaging	Het
Ceacam18	A	G	7: 43,641,841	T236A	probably benign	Het
Chst15	A	T	7: 132,269,144	Y221N	probably damaging	Het
Chst15	G	A	7: 132,269,147	L220F	probably damaging	Het
Cntn2	G	A	1: 132,518,748	T784I	probably benign	Het
D630003M21Rik	A	G	2: 158,196,493	L1011P	probably damaging	Het
Dync2h1	T	A	9: 6,996,905	D3894V	probably damaging	Het
E330017A01Rik	T	C	16: 58,636,793	I89V	probably benign	Het
Fam13b	T	C	18: 34,457,797	M443V	possibly damaging	Het
Fam20a	T	A	11: 109,673,418	Q503L	possibly damaging	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm21319	G	T	12: 87,773,431	D119E	probably benign	Het
Gm5454	T	A	13: 103,356,632		noncoding transcript	Het
Gm5581	A	G	6: 131,167,169		noncoding transcript	Het
Gm6619	A	G	6: 131,486,437	I6V	unknown	Het
Gmcl1	A	G	6: 86,714,248	M255T	probably damaging	Het
Gprc5c	T	A	11: 114,863,624	C42*	probably null	Het
Hmcn1	T	A	1: 150,737,524	E1384V	possibly damaging	Het
Il6	A	G	5: 30,018,008	I91V	probably benign	Het
Kmt2d	A	T	15: 98,862,363	S1005T	unknown	Het
Map1a	A	T	2: 121,298,910	H143L	possibly damaging	Het
Mical2	A	T	7: 112,323,659	T624S	probably benign	Het
Msh3	A	T	13: 92,286,000	N549K	possibly damaging	Het
Ncr1	T	A	7: 4,340,895	I164N	possibly damaging	Het
Olfr1333	T	G	4: 118,830,099	T115P	probably damaging	Het
Olfr554	A	G	7: 102,640,378	N44S	probably damaging	Het
Olfr586	A	T	7: 103,121,908	M292K	possibly damaging	Het
Olfr926	A	G	9: 38,877,377	D67G	probably damaging	Het
Palmd	T	C	3: 116,918,623	I541M	probably benign	Het
Pcsk7	A	T	9: 45,926,033	M552L	probably benign	Het
Plekhh2	A	G	17: 84,571,726	E626G	possibly damaging	Het
Polr2f	T	C	15: 79,151,669	I110T	probably damaging	Het
Pomt1	A	T	2: 32,248,679	I436F	probably damaging	Het
Prag1	A	C	8: 36,103,703	Q480P	probably damaging	Het
Qars	C	T	9: 108,510,242		probably benign	Het
Ralgapa2	G	A	2: 146,333,486	S1797L	probably damaging	Het
Rbm26	T	C	14: 105,128,603	T832A	probably damaging	Het
Rnf169	A	G	7: 99,925,769	S540P	probably benign	Het
Serpini1	T	A	3: 75,613,324	M76K	probably benign	Het
Shq1	A	G	6: 100,573,720	L419S	probably damaging	Het
Slc25a17	G	A	15: 81,327,060	T225M	probably damaging	Het
Slc6a5	C	A	7: 49,956,491	L716I	probably benign	Het
Smc1b	A	G	15: 85,067,783	V1149A	probably damaging	Het
Trappc1	A	T	11: 69,324,234	Q26L	possibly damaging	Het
Trpm2	C	A	10: 77,965,980	G84W	probably damaging	Het
Ttn	G	A	2: 76,742,666	T24215M	probably damaging	Het
Ubn2	C	A	6: 38,479,153	T337K	probably damaging	Het
Ubr4	A	G	4: 139,468,847	K1265E	probably damaging	Het
Vmn1r214	T	G	13: 23,035,321	I328M	probably damaging	Het
Xcr1	C	T	9: 123,855,857	C280Y	possibly damaging	Het
Zc3h13	A	G	14: 75,328,132	E895G	probably damaging	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0124:Pole	UTSW	5	110303992	missense	probably damaging	0.96
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R5990:Pole	UTSW	5	110302144	missense	probably damaging	1.00
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6019:Pole	UTSW	5	110324515	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6988:Pole	UTSW	5	110329583	missense	probably damaging	0.97
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8001:Pole	UTSW	5	110312734	missense	probably damaging	1.00
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9018:Pole	UTSW	5	110289809	missense	probably benign	0.37
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGAGTGCCATCCAGAAAATC -3'
(R):5'- GGGCAGAAATCTCAGTTTCACAC -3'

Sequencing Primer
(F):5'- GGAGTGCCATCCAGAAAATCATCAC -3'
(R):5'- TCAGTTTCACACCAGTCATAGGG -3'

Posted On

2016-12-20